UNIVERSIDADE ESTADUAL PAULISTA

“JÚLIO DE MESQUITA FILHO”

Instituto de Ciência e Tecnologia

Campus de São José dos Campos

ORIGINAL ARTICLE DOI: https://doi.org/10.4322/bds.2023.e3782

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

Streptococcus dentisani

Streptococcus mutans

no bioﬁlme dental de crianças com diferentes estados de cárie: um estudo piloto

Claudia María BEDOYA-CORREA1 , María del Pilar ANGARITA-DÍAZ2 , Edwin Alonso ARISTIZABAL PADILLA3 ,

Paula Lucero LÓPEZ JIMÉNEZ3 , Julieth BUSTAMANTE ZAPATA3 

1 - Universidad Cooperativa de Colombia, Facultad de Odontología, GIOM Group, Campus Medellín, Medellín, Antioquia, Colombia.

2 - Universidad Cooperativa de Colombia, Facultad de Odontología, GIOMET Group, Campus Villavicencio, Meta, Colombia.

3 - Universidad Cooperativa de Colombia, Facultad de Odontología, Campus Medellín, Medellín, Antioquia, Colombia.

How to cite: Bedoya-Correa CM, Angarita-Díaz MDP, Aristizabal Padilla EA, López Jiménez PL, Bustamante Zapata J.

Streptococcus

mutans

and S

treptococcus dentisani

and in dental biolm of children with different caries status: a pilot study. Braz Dent Sci.

2023;26(3):e3782. https://doi.org/10.4322/bds.2023.e3782

ABSTRACT

Objective:

Streptococcus mutans

is one of the etiological agents associated with caries due to its ability to

metabolize carbohydrates and resist acidic environments. On the other hand,

Streptococcus dentisani

, shows

characteristics associated with caries control due to its ability to inhibit growth of cariogenic bacteria. The

aim of this work was to quantify the levels of

Streptococcus mutans

and

Streptococcus dentisani

from dental

biolm of children related to their caries situation. Material and Methods: After identication of morphologic

characteristics of reference strains was performed, clinical isolates of biolm compatible with these strains were

selected and the Polymerase Chain Reaction technique was performed using species-specic primers. Biolm

samples from 25 children with caries and 21 without caries were collected to quantify the levels of

S. mutans

and

S. dentisani

. Results: There were statistically signicant differences in the levels of

S. mutans

in the caries group

and the levels increased as the severity of the carious lesion increased. By contrast, higher levels of

S. dentisani

were found in the caries-free group, although no statistically signicant differences were found. In addition,

the levels of

S. dentisani

decreased as the severity of the carious lesion increased. Conclusion: The increase

in the frequency of

S. dentisani

in the caries-free group suggests the possibility of requiring minimum levels of

this species in the dental biolm to show an actual protective effect. It must also be considered that this effect

might be related to intrinsic factors in children and the intraspecies genetic variability found in every individual.

KEYWORDS

Biolm; Clinical isolates; Dental caries;

Streptococcus dentisani; Streptococcus mutans

RESUMO

Objetivo:

Streptococcus mutans

é um dos agentes etiológicos associados à cárie devido à sua habilidade de metabolizar

carboidratos e resistir a ambientes ácidos. Já o

Streptococcus dentisani

, apresenta características associadas ao

controle da cárie devido à sua capacidade de inibir o crescimento de bactérias cariogênicas. O objetivo deste trabalho

foi quanticar os níveis de

Streptococcus mutans

Streptococcus dentisani

no biolme dental de crianças em relação

à situação de cárie destas. Material e Métodos: Após a identicação das características morfológicas das cepas de

referência, foram selecionados do biolme isolados clínicos compatíveis com essas cepas e realizada a técnica de

Reação em Cadeia da Polimerase utilizando primers espécie-especícos. Amostras de biolme de 25 crianças com cárie

e 21 sem cárie foram coletadas para quanticar os níveis de S. mutans e S. dentisani. Resultados: Houve diferenças

estatisticamente signicativas nos níveis de S. mutans no grupo com cárie e os níveis aumentaram à medida que a

gravidade da lesão cariosa aumentou. Por outro lado, foram encontrados níveis mais elevados de S. dentisani no grupo

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

INTRODUCTION

Dental caries is one of the most prevalent

worldwide conditions that affects the general

population from the early childhood [1]. It is dened

as a dynamic, non-transmissible, multifactorial

disease that is mediated by the dental biofilm

and modulated by the diet that produces a net

loss of minerals from the hard dental tissues due

to the excessive synthesis of organic acids. It is

determined by biological, behavioral, psychosocial

and environmental factors [2-4].

The oral microbiota associated with dental

caries is complex and exhibits a large number of

acidogenic species [5]. When such microorganisms

acquire a selective ecological advantage over

other species, they alter the biolm homeostasis

and initiate the disease [6]. However, although

dental caries is currently considered a disease

of polymicrobial etiology,

S. mutans

is one of

the most studied etiologic agents due to the

ability to form a biolm, produce organic acids

(acidogenicity) and tolerate and survive in acid

environments (acidurity) [7,8].

In 2014, a new streptococcal species from

the mitis group, named

S. dentisani

, was isolated

from the dental biolm of healthy individuals

who never developed caries. It is a Gram positive,

immobile and facultative anaerobic coccus that

grows at a pH of 7, even though it tolerates

slightly acidic conditions [9,10]. Results from

bioinformatics revealed that

S. dentisani

codies

multiple antimicrobial peptides, known as

bacteriocins [11], and has the ability to express

genes that activate the arginine metabolic

pathway that buffers the acid in the biolm when

a reduction in the pH is detected [9,10,12,13].

Consequently,

S. dentisani

exhibits a double

anticariogenic mechanism by inhibiting the

growth of acidogenic bacteria and stimulating

the formation of ammonium as a result of the

arginine metabolism, thus controlling the pH to

favor oral health. It might also act as a biomarker

of benecial oral bacteria [9-11].

S. mutans

has been widely studied in

children [14-16]. However, it has not been

determined whether the proportion of this

microorganism within the dental biolm in children

is conditioned by the presence of oral inhabitants

associated to health conditions, specifically by

S. dentisani

. Therefore, the objective of this

work was to quantify the levels of

S. mutans

and

S. dentisani

in the dental biolm of children

between 6 and 11 years of age with and without

the presence of dental caries.

MATERIALS AND METHODS

Study design and population

A sample of 46 children selected by

convenience was used in this transversal,

descriptive study. Children were divided into

two groups: 25 children were selected for the

caries (C) group and 21 for the non-caries

(NC) group. Children were selected from the

dental clinic at School of Dentistry, Universidad

Cooperativa de Colombia, La Inmaculada School

and children from the DAMOS Protección from

Divina Misericordia and Casa Verde Foundations

in Envigado, Antioquia, Colombia. Children

between 6 and 11 years of age was the inclusion

criteria. Exclusion criteria included the presence

of systemic conditions, orthodontic appliances,

any other oral infectious condition different

from dental caries and the use of antibiotic

therapy during the previous three months

before sample collection. Children from the NC

group did not have a previous history of dental

caries. Parents and/or legal representatives, as

well as participating children, received detailed

information on the study and signed an informed

consent and an informed assent.

Clinical examination

In order to select the children, a clinical

examination was performed, following a previous

sem cáries, embora não tenham sido encontradas diferenças estatisticamente signicativas. Além disso, os níveis de S.

dentisani diminuíram à medida que a gravidade da lesão cariosa aumentava. Conclusão: O aumento da frequência

de S. dentisani no grupo livre de cárie sugere a possibilidade de exigir níveis mínimos desta espécie no biolme dental

para mostrar um efeito protetor real. Deve-se considerar também que esse efeito pode estar relacionado a fatores

intrínsecos nas crianças e à variabilidade genética intraespécie encontrada em cada indivíduo.

PALAVRAS-CHAVE

Biolme; Cárie dentária;

Streptococcus mutans

;

Streptococcus dentisani

; Isolados clínicos

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

calibration process, to identify the caries status

using the ICDAS (International Caries Detection

and Assessment System). According to ICDAS,

children were grouped in a caries-free (NC) group

for ICDAS 0; white spot lesions (WSL) group for

ICDAS 1 and 2 and Cavity lesions (CL) group for

ICDAS 3 to 6

Dental biolm sample collection

Before sample collection, the visible index

plaque was determined using the modied Silness

and Löe index, and a classication of the oral

hygiene index was performed according to the

percentage of dental surfaces that showed oral

biolm as follows: good oral hygiene (0-15%),

moderate (16-30%) and bad (31-100%) [17].

Biofilm samples of the caries and caries-free

groups were collected from the buccal surface

of the first permanent molar. In the caries

group, samples were collected directly from the

accumulated biolm within the active carious

lesion (white spot or cavity) only if such lesions

were present at the first permanent molar.

Samples were collected with a 1µL-calibrated

and were transferred to 500µL of 0.9% saline

with glass bids to disaggregate the biolm and

stored at 4°C for further processing within the

following two hours.

Macroscopic characterization and identica-

tion of reference bacterial strains

Before sample collection, visual calibration

was performed to recognize the morphology

S. mutans

and

S. dentisani

colonies.

S. mutans

ATCC 25175 and

S. dentisani

CECT

7746 reference strains were used.

S. mutans

was grown in Mitis Salivarius (MS) agar

(Difco Laboratories, Le pont de claix, France),

supplemented with 1% potassium tellurite

(Lab M Ltd, Lancashire, UK), 10% sucrose

(Fisher Chemical, Waltham, USA) and 0.2 U

mL-1 bacitracin (Sigma-Aldrich, Missouri, USA),

and incubated in microaerophilic conditions

at 37°C for 48 h in a 5% CO2 atmosphere.

S. dentisani

was grown in Brain Heart Infusion

(BHI) agar (Difco Laboratories, Le pont de claix,

France) and incubated in aerophilic conditions

at 37°C for 48 h. Colonies were macroscopically

observed at 8-32X magnication and a highly

detailed review and description of the phenotypic

features of the colonies from each strain was

performed.

Molecular identication of

S. mutans

and

S. dentisani

In order to calibrate the macroscopic

recognition of

S. mutans

and

S. dentisani

colonies, a molecular identication using the

polymerase chain reaction (PCR) test was

performed. 1µL of dental biolm from NC and

C children was obtained and serial dilutions

in 0.9% saline solution were performed.

For

S. mutans

, 100µL of 10-1-10-3 dilutions

were cultured in MS agar and incubated

in microaerophilic conditions at 37°C for

48 h (5% CO2). 100µL of 10-1-10-3 dilutions

were cultured in BHI agar and incubated in

microaerophilic conditions at 37°C for 48 h to

isolate colonies compatible with

S. dentisani

After the incubation period, 35 clinical isolates

phenotypically compatible with

S. mutans

and 35 with

S. dentisani

(70 isolates in total)

were selected. For DNA extraction, each isolate

was cultured in 5mL of BHI broth (Oxoid,

Basingstoke, UK) supplemented with 5% sucrose

and incubated under the aforementioned

conditions.

Extraction and purication of genomic DNA

Pure cultures were centrifuged (Thermo

Scientific Sorvall ST16, Waltham, USA) at

2800g for 3 min at 4°C. Cultures were washed

two times with 500µL of ultra-pure water; the

rst was centrifuged at 2800g for 4 min at 4°C

and the second at 21000g for 2 min at 4°C.

The supernatant was discarded and the pellet

was re-suspended in 150µL of Tris-EDTA buffer.

Then, cell lysis by ebullition of the suspension

at 95°C for 10 min was performed. Lastly, it

was centrifuged at 21000g for 5 min at 4°C to

recover the supernatant containing the genomic

DNA and frozen at -20°C. DNA purification

was performed by ethanol and 3M sodium

acetate [15] precipitation. Spectrophotometric

measures using a MicroDrop (Thermo Scientic

Multiskan GO, Walthman, USA) were used to

establish DNA concentration and purity.

Identication of

S. mutans

by PCR

Species-specific primers to amplify the

glucosyltransferase B gene (

gtfB

) were used

to confirm that the selected clinical isolates

corresponded to

S. mutans

(Table I) [18]. Each

25µL of the PCR mix contained 1X Taq buffer with

20mM (NH4)2SO4, 2.5mM of MgCl2, 0.4µM of each

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

oligonucleotide primer, 0.2mM of each dNTP,

0.5U of Taq DNA polymerase and 2µL of DNA at

a concentration of 50ng. Samples were amplied

in a thermal cycler (MultiGene OptiMaxl, Edison,

NJ, USA) under the following PCR conditions:

initial denaturalization at 94°C for 1 min, followed

by 34 denaturalization cycles at 94°C for 30 s,

hybridization at 60°C for 35 s and extension at

72°C for 50 s. The nal step was extension for

7 min. PCR amplied products were analyzed by

1.5% agarose gel electrophoresis, stained with

ethidium bromide (0.5 µg mL-1) and photographed

under UV light. A marker of DNA molecular weight

of 1kb in each gel was used. A negative control

(Master mix without DNA) and a positive control

(

S. mutans

25175) were included.

Identication of

S. dentisani

by PCR

Species-specic primers to amplify a segment

of the carbamate kinase gene (

arc

) were used

to confirm that the selected clinical isolates

corresponded to

S. dentisani

(Table I) [10]. Each

25µL of the PCR mix contained 1X Taq buffer with

20mM (NH4)2SO4, 2.5mM of MgCl2, 0.4µM of each

oligonucleotide primer, 0.2mM of each dNTP,

0.5U of Taq DNA polymerase and 2µL of DNA at

a concentration of 50ng. Samples were amplied

in a thermal cycler (MultiGene OptiMaxl, Edison,

NJ, USA) under the following PCR conditions:

initial denaturalization at 94°C for 1 min, followed

by 34 denaturalization cycles at 94°C for 30 s,

hybridization at 65°C for 40 s and extension at

72°C for 50 s. The nal step was extension for

7 min. PCR amplied products were analyzed by

3.5% agarose gel electrophoresis, stained with

ethidium bromide (0.5 µg mL-1) and photographed

under UV light. A marker of DNA molecular weight

of 50pb in each gel was used. A negative control

(Master mix without DNA) and a positive control

(

S. dentisani

CECT 7746) were included.

Microbiologic processing of dental biolm

samples

After validation of the macroscopic

recognition of the

S. mutans

and

S. dentisani

clinical isolates with the molecular identication,

1µL of dental biolm from NC and C children

was obtained. Serial dilutions were performed

and inoculated into the aforementioned culture

media. Samples were incubated for 48 h at 37°C.

After incubation,

S. mutans

and

S. dentisani

colony count was performed and reported as

colony-forming units per microliter of dental

biolm (UFC/µL).

Figure 1 summarizes the phases of the study

carried out to quantify the levels of

S. mutans

and

S. dentisani

in the dental biolm of children with

and without dental caries.

Statistical analysis

Statistical analysis was performed with the

SPSS V.25 (IBM Corp, Armonk, NY, USA) software.

A descriptive analysis of the oral health

status of the studied population by estimation

Table I - Primers and reference strains used for PCR identiﬁcation of the clinical isolates from NC and C dental bioﬁlm

Primers Sequence (5’ - 3’) Target Size (bp) Control strain

CkSdF GTAAC CAACCGCCCAGAAGG

arcC

S. dentisani

CkSdR CCGCTTTCGGA CTCGATCA CECT 7746

GTFB-F ACTACACTTTCGGGTGGCTTGG

gtfB

517

S. mutans

GTFB-R CAGTATAAGCGCCAGTTTCATC ATCC 25175

Figure 1 - Phases of the study carried out to quantify the levels of

S. mutans

and

S. dentisani

and in the dental bioﬁlm of children with

and without dental caries.

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

of proportions or summary measures according

to the nature of the variables was carried out.

In order to compare the number of

S. mutans

and

S. dentisani

viable cells, as well as the numbers

obtained in the different phases of the carious

lesion in the C group, a bivariate analysis using

the Mann Whitney U test after verication of

the normality using the Shapiro Wilk test was

performed. P<0.05 values were considered

statistically signicant for all the analyses.

RESULTS

Out of the 46 samples of dental biofilm,

45.7% corresponded to the NC group and 54.3%

to the C group. It was determined that all children

showed poor oral hygiene after evaluation of the

modied Silness y Löe plaque index, although

19% of the NC and 4% of the C children exhibited

moderate oral hygiene. The C group showed a

higher percentage of children with decient oral

hygiene compared to the NC group. After clinical

evaluation, a recodication of the ICDAS system

was performed and three categories were created:

non-caries (NC), white spot lesion (WSL) and

cavity lesion (CL). Table II shows the distribution

of the evaluated characteristics.

After visual calibration and identication of

the morphologic characteristics of the 70 clinical

isolates of dental biolm, PCR tests demonstrated

that 35 (100%) corresponded to

S. mutans

and

35 (100%) to

S. dentisani

Quantication of

S. mutans

and

S. dentisani

in the dental biolm from children with and

without caries

Statistically significant differences were

found in the number of

S. mutans

viable cells in

both groups (p=0.007), and when a comparison

between NC and CL groups was made (p=0.001).

Even though the distribution frequency of

dentisani

in the NC group was a little higher, no

statistically significant differences were found

between groups (p=0.175), nor when a comparison

between NC and WSL groups (p=0.38) and CL

group (p=0.17) (Table III) was made.

Relation between the presence of

S. mutans

and

S. dentisani

in different types of carious

lesions

Figure 2 shows the distribution of

S. mutans

was higher in children with more severe cavity

Table II - Characteristics of the evaluated children

NC group

(n=21)

C group

(n=25)

Age in years (Mean ± SD)

8 ± 2 9 ± 2

Gender n (%) n (%)

Male 7 (33.3) 17 (68)

Female 14 (66.7) 8 (32)

Oral hygiene n (%) n (%)

Good 0 (0) 0 (0)

Moderate 4 (19) 1 (4)

Deﬁcient 17 (81) 24 (96)

ICDAS

Categories n (%)

NC 21 (45.6)

WSL 13 (28.3)

CL 12 (26.1)

SD: Standard deviation. NC: Non-caries. WSL: White spot lesion.

CL: Cavity lesion.

Table III - Number of

S. mutans

and

S. dentisani

viable cells from

non-caries group (NC), caries group (C), white spot lesion (WSL)

and cavity lesion (CL)

CFU µL-1 Categories p-value

S. mutans

Median (IQR)

NC group

0.007**

1.5 x 102 (0.0 - 2.4 x 103)

C group

5.0 x 103 (3.5 x 102 - 3.7 x 104)

NC group

0.18

1.5 x 102 (0.0 - 2.4 x 103)

WLS

7.0 x 102 (5.0 x 101 - 5.8 x 104)

NC group

0.001**

1.5 x 102 (0.0 - 2.4 x 103)

2.3 x 104 (4.1 x 103 - 6.0 x 104)

CFU µL-1 Categories p-value

S. dentisani

Median (IQR)

NC group

0.175

5.4 x 104 (1.2 x 104 - 1.5 x 105)

C group

2.4 x 104 (9.5 x 103 - 5.8 x 104)

NC group

0.38

5.4 x 104 (1.2 x 104 - 1.5 x 105)

WLS

3.8 x 104 (1.0 x 104- 6.4 x 104)

NC group

0.17

5.4 x 104 (1.2 x 104 - 1.5 x 105)

1.1 x 104 (5.0 x 103 - 1.0 x 105)

**p<0.05. Mann–Whitney U test. IQR: Interquartile range. NC: Non-

caries group, C: Caries group, WSL: White spot lesion, CL: Cavity lesion.

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

lesions and progressively reduced as the severity

of the lesion decreased. In healthy patients, such

number was very low. Despite nding signicant

differences and a higher number of

S. mutans

viable cells in group C,

S. mutans

was absent

in three children with active carious lesions

(WSL, n=2; CL, n=1). However, considerable

amounts of

S. dentisani

were found in the same

samples (Table IV). In contrast, the proportion

S. dentisani

was higher in the dental biolm

of children from the NC group and gradually

decreased as the severity of the lesion increased

(Figure 3). It is relevant to highlight that

S. mutans

was absent in the biofilm of 9 NC children,

but levels of

S. dentisani

were high (median

1.2x105 CFU µL-1) (Table IV).

DISCUSSION

Conventional microbiological cultures

constitute an adequate tool to quantify and

characterize the isolated microorganisms in

the oral cavity. However, it is necessary to

implement additional molecular techniques,

such as PCR, to validate the identification of

bacterial species [19]. Microbiological and

molecular methods employed in the current

investigation allowed for a correct macroscopic

characterization and visual calibration of the

colonies from the studied bacterial strains before

determining the prevalence of

S. mutans

and

S. dentisani

in the biolm of children with and

without caries.

S. mutans

was detected in most samples from

dental biolm of children irrespective of their

caries status. However, statistically signicant

differences have been found in the levels of

mutans

in children with and without dental

caries (p<0.05). This species was found in higher

numbers in the dental biolm from children with

cavity carious lesions and such numbers decreases

considerably in children without caries. These

results are in agreement with published results

by other authors who found a positive correlation

between the levels of

S. mutans

and the onset and

progression of dental caries [20-22]. Likewise,

other investigations have demonstrated a

higher genetic variability in clinical isolates

from cavity lesions, which may be related to the

physiopathology of

S. mutans

[15,23].

The results of the present work suggest

that

S. mutans

plays a significant role in the

progression of dental caries by participating in the

destruction of the hard dental tissues. Therefore, it

is mandatory to develop treatment and preventive

strategies directed at maintaining the homeostasis

Table IV - Prevalence of

S. dentisani

in samples from the bioﬁlm of

children with undetectable levels of

S. mutans

S. mutans S. dentisani

CFU µL-1 CFU µL-1

0.0 1.1x104

0.0 2.7x105

0.0 1.3x104

0.0 2.8x105

0.0 5.6x104

0.0 1.6x105

0.0 4.5x102

0.0 2.9x105

0.0 1.2x105

WSL

0.0 7.1x104

0.0 2.4x104

0.0 1.0x104

NC: Non-caries, WSL: White spot lesion, CL: Cavity lesion.

Figure 2 - Distribution of

S. mutans

according to caries status.

Number of viable cells. ICDAS recodiﬁcation: NC, without caries;

WSL, white spot lesion; CL, cavity lesion. **p˂0.05. Mann–Whitney

U test. Signiﬁcant diﬀerences between NC and CL groups.

Figure 3 - Distribution of

S. dentisani

according to caries status.

Number of viable cells. ICDAS recodiﬁcation: NC, without caries;

WSL, white spot lesion; CL, cavity lesion.

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

of the oral cavity, such as probiotics, and reducing

the levels of

S. mutans

and other acidogenic

species that coexist within the dental biolm.

S. dentisani

has exhibited benecial effects

that may assist in promoting oral health, including

antibacterial activity against oral pathogens by

producing bacteriocins, increasing the pH by

producing ammonium and anti-inflammatory

activities that favor the immune response thus

exhibiting probiotic properties [10,12,24]. 100% of

the samples exhibited the presence of

S. dentisani

despite the absence of significant differences

between groups, it was possible to nd

S. dentisani

in biolm samples of children with undetectable

levels of

S. mutans.

In addition, a higher proportion

S. dentisani

was found in the samples from the

NC group and such numbers decreased as the

severity of the carious lesion increased. This nding

may indicate that this bacterial species probably

plays a protective role against acidogenic species

that promote the onset of carious lesions. But, it

is possible that the benecial effect of

S. dentisani

requires minimum levels of this species to be

effective, although the fact that this protective

effect responding to intra-species genotypic

variability and the presence of

S. dentisani

specic

genotypes cannot be ruled out. It is also important

to consider intrinsic factors in children, such as

sugar consumption, physico-chemical properties

of saliva and use of uoride-containing products.

Further epidemiological and molecular studies are

essential to understand the protective role of this

species in the control of cariogenic microorganisms.

Similar results were found in a study that

assessed the biolm from 100 Colombian children

with and without dental caries. The presence of

dentisani

was identied and quantied by qPCR

in all the patients, but higher numbers were found

in the children without caries, despite that the

differences were not statistically signicant [25].

López-Santacruz et al. [26] quantied by qPCR the

presence of

S. dentisani

in supragingival biolm

samples collected from different teeth of Mexican

children (25 without and 29 with caries) and

found higher numbers of this species in the group

without caries and a negative correlation between

the severity of the carious lesion and the presence

S. dentisani

. These authors concluded that this

species seems to be present in higher numbers in

the dental biolm of children without dental caries.

In vitro

studies have demonstrated a

signicant inhibitory effect by

S. dentisani

in the

growth of several oral pathogens. However, such

experiments were performed using reference strains,

planktonic cultures, and controlled laboratory

conditions [10,12,13]. Nonetheless, the evidence

shows that multiple microbial and metabolic

interactions occur under

in vivo

conditions that

may promote eubiosis status or alter the balance

within the oral cavity [27,28]. Therefore, the

results of this investigation are not consistent with

published literature since the processed samples

were obtained directly from dental biolm and

the oral cavity exhibits a high heterogeneity.

In addition, bacterial adaptation and colonization

to specic microsites may vary considerably among

individuals [27]. The dental biolm is composed

by a multispecies complex that may interact

synergistically or antagonistically, thus interrupting

the antibacterial effect exhibited by

S. dentisani.

Limitations of the current investigation

include the low sample size and intrinsic

variability of the children within each group.

The lack of statistical signicance may be related

to the fact that biolm was collected from only

one tooth, which does not represent the complete

oral cavity. Therefore, it is recommended to

continue this work in the future using pooled

samples from different teeth to ensure that the

assessed bacterial composition is representative

of the whole dental plaque microbial community.

Acknowledgements

The authors would like to thank Dr. Monica

Parada-Sanchez for providing the species-specic

primers for identication of

S. mutans

, to John

Franco for his invaluable statistical analysis

and Dr. Santiago Arango for reviewing the

manuscript.

Author’s Contributions

CMBC, MDPAD: Conceptualization,

Methodology, Resources, Data Curation,

Writing – review and editing, Supervision,

Project administration and Funding Acquisition.

CMBC, MDPAD, EAAP, PLLJ, JBZ: Investigation,

Writing – original draft preparation.

Conﬂict of interest

The authors declare that they have no

conict of interest.

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

Funding

This work was supported by the Universidad

Cooperativa de Colombia [INV3011].

Regulatory Statement

The study was approved by the ethics

committee from Universidad Cooperativa de

Colombia, Medellín campus (004/2018).

REFERENCES

1. Wong A, Subar PE, Young DA. Dental caries. Adv Pediatr.

2017;64(1):307-30. http://dx.doi.org/10.1016/j.yapd.2017.03.011.

PMid:28688595.

2. Chen X, Daliri EB, Chelliah R, Oh DH. Isolation and Identification

of Potentially Pathogenic Microorganisms Associated with dental

caries in human teeth biofilms. Microorganisms. 2020;8(10):1596.

http://dx.doi.org/10.3390/microorganisms8101596.

PMid:33081291.

3. Kuramitsu HK, He X, Lux R, Anderson MH, Shi W. Interspecies

interactions within oral microbial communities. Microbiol

Mol Biol Rev. 2007;71(4):653-70. http://dx.doi.org/10.1128/

MMBR.00024-07. PMid:18063722.

4. Machiulskiene V, Campus G, Carvalho JC, Dige I, Ekstrand KR,

Jablonski-Momeni A, etal. Terminology of dental caries and

dental caries management: consensus report of a workshop

organized by ORCA and cariology research group of IADR. Caries

Res. 2020;54(1):7-14. http://dx.doi.org/10.1159/000503309.

PMid:31590168.

5. Belstrøm D, Constancias F, Liu Y, Yang L, Drautz-Moses DI,

Schuster SC,et al. Metagenomic and metatranscriptomic

analysis of saliva reveals disease-associated microbiota in

patients with periodontitis and dental caries. NPJ Biofilms

Microbiomes. 2017;3(1):23. http://dx.doi.org/10.1038/s41522-

017-0031-4. PMid:28979798.

6. Philip N, Suneja B, Walsh LJ. Ecological approaches to dental

caries prevention: paradigm shift or shibboleth? Caries Res.

2018;52(1-2):153-65. http://dx.doi.org/10.1159/000484985.

PMid:29320767.

7. Banas JA. Virulence properties of Streptococcus mutans. Front

Biosci. 2004;9(1-3):1267-77. http://dx.doi.org/10.2741/1305.

PMid:14977543.

8. Palmer SR, Miller JH, Abranches J, Zeng L, Lefebure T, Richards

VP,etal. Phenotypic heterogeneity of genomically-diverse isolates

of Streptococcus mutans. PLoS One. 2013;8(4):e61358. http://

dx.doi.org/10.1371/journal.pone.0061358. PMid:23613838.

9. Camelo-Castillo A, Benítez-Páez A, Belda-Ferre P, Cabrera-Rubio

R, Mira A. Streptococcus dentisani sp. nov., a novel member of

the mitis group. Int J Syst Evol Microbiol. 2014;64(Pt 1):60-5.

http://dx.doi.org/10.1099/ijs.0.054098-0. PMid:24006481.

10. López-López A, Camelo-Castillo A, Ferrer MD, Simon-Soro Á,

Mira A. Health-associated niche inhabitants as oral probiotics:

the case of Streptococcus dentisani. Front Microbiol. 2017;8:379.

http://dx.doi.org/10.3389/fmicb.2017.00379. PMid:28344574.

11. Conrads G, Westenberger J, Lürkens M, Abdelbary MMH.

Isolation and bacteriocin-related typing of Streptococcus

dentisani. Front Cell Infect Microbiol. 2019;9:110. http://dx.doi.

org/10.3389/fcimb.2019.00110. PMid:31041198.

12. Esteban-Fernández A, Ferrer MD, Zorraquín-Peña I, López-

López A, Moreno-Arribas MV, Mira A. In vitro beneficial effects

of Streptococcus dentisani as potential oral probiotic for

periodontal diseases. J Periodontol. 2019;90(11):1346-55. http://

dx.doi.org/10.1002/JPER.18-0751. PMid:31111495.

13. Llena C, Almarche A, Mira A, López MA. Antimicrobial efficacy of

the supernatant of Streptococcus dentisani against microorganisms

implicated in root canal infections. J Oral Sci. 2019;61(1):184-94.

http://dx.doi.org/10.2334/josnusd.18-0239. PMid:30918216.

14. Martínez-Pabón MC, Ramírez-Puerta BS, Escobar-Paucar

GM, Franco-Cortés AM. Physicochemical salivary properties,

lactobacillus, mutans streptococci counts and early childhood

caries in preschool children of Colombia. Acta Odontol Latinoam.

2010;23(3):249-56. PMid:21638968.

15. Rincón-Rodríguez RJ, Parada-Sanchez MT, Bedoya-Correa CM,

Arboleda-Toro D. Genetic diversity of Streptococcus mutans

serotype c isolated from white spot and cavitated caries lesions

from schoolchildren. Arch Oral Biol. 2019;100:33-41. http://

dx.doi.org/10.1016/j.archoralbio.2019.02.003. PMid:30776704.

16. Bottner A, He RY, Sarbu A, Nainar SMH, Dufour D, Gong

SG,et al. Streptococcus mutans isolated from children with

severe-early childhood caries form higher levels of persisters.

Arch Oral Biol. 2020;110:104601. http://dx.doi.org/10.1016/j.

archoralbio.2019.104601. PMid:31734540.

17. Martignon S, González MC, Ruiz JA, McCormick V. Guía de

práctica clínica para el diagnóstico, prevención y tratamiento

de la caries dental [Internet]. Bogotá: Secretaría distrital de

salud; 2007 [cited 17 April 2023]. Available from: http://www.

saludcapital.gov.co/DSP/Documentos%20Salud%20Oral/

Gu%C3%ADa%20de%20Pr%C3%A1ctica%20Cl%C3%ADnica%20

en%20Salud%20Oral%20-%20Caries%20Dental.pdf

18. Oho T, Yamashita Y, Shimazaki Y, Kushiyama M, Koga T. Simple

and rapid detection of Streptococcus mutans and Streptococcus

sobrinus in human saliva by polymerase chain reaction.

Oral Microbiol Immunol. 2000;15(4):258-62. http://dx.doi.

org/10.1034/j.1399-302x.2000.150408.x. PMid:11154412.

19. Nyvad B, Crielaard W, Mira A, Takahashi N, Beighton D. Dental

caries from a molecular microbiological perspective. Caries

Res. 2013;47(2):89-102. http://dx.doi.org/10.1159/000345367.

PMid:23207320.

20. Pieralisi FJS, Rodrigues MR, Segura VG, Maciel SM, Ferreira FBA,

Garcia JE,etal. Genotypic diversity of Streptococcus mutans

in caries-free and caries-active preschool children. Int J Dent.

2010;2010:824976. http://dx.doi.org/10.1155/2010/824976.

PMid:20351760.

21. Nanda J, Sachdev V, Sandhu M, Deep-Singh-Nanda K. Correlation

between dental caries experience and mutans streptococci counts

using saliva and plaque as microbial risk indicators in 3-8 year old

children. A cross sectional study. J Clin Exp Dent. 2015;7(1):e114-8.

http://dx.doi.org/10.4317/jced.51814. PMid:25810821.

22. Lembo FL, Longo PL, Ota-Tsuzuki C, Rodrigues CR, Mayer M.

Genotypic and phenotypic analysis of Streptococcus mutans

from different oral cavity sites of caries-free and caries-active

children. Oral Microbiol Immunol. 2007;22(5):313-9. http://

dx.doi.org/10.1111/j.1399-302X.2007.00361.x. PMid:17803628.

23. Bedoya-Correa CM, Rincón-Rodríguez RJ, Parada-Sanchez MT.

Acidogenic and aciduric properties of Streptococcus mutans

serotype c according to its genomic variability. Eur J Oral

Sci. 2021;129(6):e12824. http://dx.doi.org/10.1111/eos.12824.

PMid:34865249.

24. Ferrer MD, López-López A, Nicolescu T, Perez-Vilaplana

S, Boix-Amorós A, Dzidic M,et al. Topic application of the

probiotic Streptococcus dentisani improves clinical and

microbiological parameters associated with oral health. Front

Cell Infect Microbiol. 2020;10:465. http://dx.doi.org/10.3389/

fcimb.2020.00465. PMid:32984080.

25. Angarita-Díaz MP, Díaz JA, Tupaz HA, López-López A, Forero D,

Mira A,etal. Presence of Streptococcus dentisani in the dental

plaque of children from different Colombian cities. Clin Exp

Braz Dent Sci 2023 July/Sept;26 (3): e3782

Bedoya-Correa CM et al.

Streptococcus mutans and Streptococcus dentisani and in dental biofilm of children with different caries status: a pilot study

Bedoya-Correa CM et al. Streptococcus mutans and Streptococcus dentisani in dental

bioﬁlm of children with diﬀerent caries status: a pilot study

Dent Res. 2019;5(3):184-90. http://dx.doi.org/10.1002/cre2.158.

PMid:31249697.

26. López-Santacruz HD, López-López A, Revilla-Guarinos A,

Camelo-Castillo A, Esparza-Villalpando V, Mira A, etal.

Streptococcus dentisani is a common inhabitant of the oral

microbiota worldwide and is found at higher levels in caries-

free individuals. Int Microbiol. 2021;24(4):619-29. http://dx.doi.

org/10.1007/s10123-021-00222-9. PMid:34731341.

27. Simón-Soro A, Tomás I, Cabrera-Rubio R, Catalan MD,

Nyvad B, Mira A. Microbial geography of the oral

cavity. J Dent Res. 2013;92(7):616-21. http://dx.doi.

org/10.1177/0022034513488119. PMid:23674263.

28. Mira A, Simon-Soro A, Curtis MA. Role of microbial communities

in the pathogenesis of periodontal diseases and caries. J

Clin Periodontol. 2017;44(Suppl 18):S23-38. http://dx.doi.

org/10.1111/jcpe.12671. PMid:28266108.

Claudia María Bedoya-Correa

(Corresponding address)

Universidad Cooperativa de Colombia, Facultad de Odontología, Medellín,

Antioquia, Colombia

Email: claudia.bedoyac@campusucc.edu.co

Date submitted: 2023 Jan 01

Accepted submission: 2023 May 01