UNIVERSIDADE ESTADUAL PAULISTA
“JÚLIO DE MESQUITA FILHO”
Instituto de Ciência e Tecnologia
Campus de São José dos Campos
ORIGINAL ARTICLE DOI: https://doi.org/10.4322/bds.2024.e3827
1
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
A deficiência de estrógeno influencia a expressão gênica de SEC23A na região odontogênica de incisivos – um estudo
em modelo murino
Clara Costa do NASCIMENTO
1
, Marcus Augusto SILVEIRA
1
, Millena Cristina de PAULA
1
, Martinelle Ferreira da Rocha TARANTO
1
,
Agnes SCHRÖDER2 , Christian KIRSCHNECK2 , Paulo NELSON-FILHO3 , César Penazzo LEPRI4 , Flares BARATTO-FILHO5,6 ,
Erika Calvano KÜCHLER4,5 , Isabela Ribeiro MADALENA1,4,6
1 - Centro Universitário Presidente Tancredo de Almeida Neves, Faculdade de Odontologia. São João del Rei, MG, Brazil.
2 - University of Regensburg, Department of Orthodontics. Regensburg, Germany.
3 - Universidade de São Paulo, Faculdade de Odontologia de Ribeirão Preto, Departamento de Clínica Infantil. Ribeirão Preto, SP, Brazil.
4 - Universidade de Uberaba, Departamento de Biomateriais. Uberaba, MG, Brazil.
5 - Universidade Tuiuti do Paraná, Faculdade de Odontologia. Curitiba, PR, Brazil.
6 - Universidade da Região de Joinville, Departamento de Odontologia. Joinville, SC, Brazil.
How to cite: Nascimento CC, Silveira MA, Paula MC, Taranto MFR, Schröder A, Kirschneck C, et al. Estrogen deciency inuences SEC23A gene
expression in the odontogenic region of incisors – a murine model study. Braz Dent Sci. 2024;27(1):e3827. https://doi.org/10.4322/bds.2024.e3827
ABSTRACT
Recent scientic evidence suggests a close relationship between estrogen deciency and vitamin D- related genes. Estrogen and
vitamin D were involved with alterations in odontogenesis and tooth eruption process. Objective: The aim of the present study was
to evaluate the inuence of estrogen deciency on the expression of genes related to the activation and degradation of vitamin D in
the odontogenic region of incisors in a murine model. Material and Methods: This is an experimental clinical study that used female
Wistar Hannover rats. The animals were randomly divided into two groups according to the intervention received: Hypoestrogenism
Group – animals submitted to estrogen deciency by ovariectomy surgery and Control Group – animals submitted to sham surgery.
Surgical intervention was performed in the prepubertal period; the animals were followed throughout the pubertal period. After
euthanasia, the hemimandibles were removed to evaluate the mRNA expression of the vitamin D-related genes AMDHD1, CYP24A1,
NADSYN1 and SEC23A in the odontogenic region of incisors through real time PCR. Student’s t test was used to compare means.
Kruskal-Wallis test and Dunn’s posttest were also used. The level of signicance was 5%. Results: SEC23A was overexpressed in the
estrogen deciency condition in the odontogenic region (p=0.021). Conclusion: Estrogen deciency may inuence the expression
of the SEC23A gene involved in the activation and degradation of vitamin D in the odontogenic region of incisors in a murine model.
KEYWORDS
Estrogen; 25-hydroxyvitamin D3; Gene expression; Odontogenesis; Vitamin D.
RESUMO
Evidências cientícas recentes sugerem uma estreita relação entre a deciência de estrógeno e os genes relacionados à vitamina D.
O estrógeno e a vitamina D estão envolvidos com alterações na odontogênese e no processo de erupção dentária. Objetivo: O objetivo
do presente estudo foi avaliar a inuência da deciência de estrógeno na expressão de genes relacionados à ativação e degradação
da vitamina D na região odontogênica de incisivos em modelo murino. Material e Métodos: Trata-se de um estudo clínico
experimental que utilizou ratas Wistar Hannover fêmeas. Os animais foram divididos aleatoriamente em dois grupos de acordo com
a intervenção recebida: Grupo Hipoestrogenismo – animais submetidos à deciência de estrógeno pela cirurgia de ovariectomia e
Grupo Controle – animais submetidos à cirurgia simulada. A intervenção cirúrgica foi realizada no período pré-púbere; os animais
foram acompanhados durante todo o período puberal. Após a eutanásia, as hemimandíbulas foram removidas para avaliar a expressão
de mRNA dos genes AMDHD1, CYP24A1, NADSYN1 e SEC23A, relacionados à vitamina D, na região odontogênica de incisivos
por meio de PCR em tempo real. O teste t de Student foi utilizado para comparar as médias. Também foram utilizados o teste de
Kruskal-Wallis e o pós-teste de Dunn. O nível de signicância foi de 5%. Resultados: SEC23A foi superexpresso na condição de
deciência de estrógeno na região odontogênica (p=0,021). Conclusão: A deciência de estrógeno pode inuenciar a expressão do
gene SEC23A envolvido na ativação e degradação da vitamina D na região odontogênica de incisivos em modelo murino.
PALAVRAS-CHAVE
Estrógeno; 25-hidroxi-vitamina D3; Expressão gênica; Odontogênese; Vitamina D.
2
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
Nascimento CC et al.
Estrogen deficiency influences SEC23A gene expression in the odontogenic region of incisors – a murine model study
Nascimento CC et al. Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
INTRODUCTION
Estrogen is a steroid hormone present and
active throughout an individual’s life [1]. Although
it is mainly responsible for female characteristics,
it also important in the neuroendocrine, vascular,
skeletal and immune systems of both sexes
and dental development/tooth eruption [2-4].
Imbalances in serum estrogen levels can cause
signicant changes in body homeostasis. Growing
scientic evidence indicates that imbalances in
estrogen levels compromise the gene expression
of its main intracellular receptors,
ESR1
and
ESR2
, and consequently, the physiological
development of several structures, in special,
involved in craniofacial development [3,5-7].
Vitamin D is an important component in
the biosynthesis of estrogen in the female and
male body [8]. Vitamin D represents a group of
fat-soluble steroid hormones obtained mainly
through exposure of the skin to UVB irradiation
by sunlight [9]. In addition to the biological
effects of vitamin D being mediated by binding to
its intracellular receptor, the vitamin D receptor,
other important genes should also be cited. The
amidohydrolase domain containing 1 (AMDHD1),
the cytochrome P450 family 24 subfamily A
member 1 (CYP24A1), the NAD synthetase 1
(NADSYN1) and the Sec23 homolog A (SEC23A)
are related to the synthesis, activation and
degradation of vitamin D [9]. Vitamin D deciency,
in turn, is signicant to bone homeostasis [9], host
immune response [10], the development of the
stomatognathic system and teeth [8,11] and risk
of the main oral diseases [12,13]. Estrogen have
a close relationship with Vitamin D [14]. When
estrogen is decient, low levels of vitamin D can
also be observed [15].
Odontogenesis and tooth eruption process
are strongly influenced by several local,
systemic, environmental, genetic, and epigenetic
factors [2-4,7,16]. There is some scientific
evidence coming from studies in animal models
showing that estrogen receptors are expressed
in cells in the odontogenic region of teeth with
continuous growth (incisors) [2-4]. There is also
evidence demonstrating that vitamin D and its
receptor are involved in tooth development [17].
Our hypothesis is that estrogen deciency may
alter the expression of vitamin D related genes.
Thus, the aim of the present study was to
evaluate the inuence of estrogen deciency on
the expression of genes related to the activation
and degradation of vitamin D in the odontogenic
region of incisors in a murine model.
MATERIAL AND METHODS
Ethical aspects
This study was submitted to the Ethics
Committee on the Use of Animals of the School of
Dentistry of Ribeirão Preto – University of São Paulo
FORP/USP and was approved (#2018.1.40.58.3).
This research was performed and reported
according to the ARRIVE guidelines [18].
Experimental design
This is an
in vivo
experimental study. Specimens
from a previous study by Madalena et al. [3],
were used to analyze the mRNA expression of
genes related to the activation and degradation
of vitamin D in the odontogenic region of teeth
in continuous growth. Estrogen deciency was
caused by ovariectomy surgery (Experimental
group) (n=8), and the control group underwent
fictitious surgery (Control group) (n=9). The
animals underwent intervention in the prepubertal
period and were euthanized after the pubertal
period was completed. After euthanasia, the
hemimandibles were removed and sectioned
in the region of the condyle, coronoid process,
and ramus of the mandible in order to isolate
the odontogenic region of the lower incisor. The
section of the hemimandible was performed with
a 7011 double-sided diamond disc (KG Sorensen,
Cotia, BR) with a thickness of 0.18 mm [2-4]. The
mRNA samples from the odontogenic region were
submitted to quantication of the gene expression
of AMDHD1, CYP24A1, NADSYN1 and SEC23A.
Figure 1 shows the chronology of procedures
carried out in this study.
Sampling of animals
Seventeen 21-day-old female Wistar rats
were obtained from the animal facility of Ribeirão
Preto, University of São Paulo, Brazil, were stored
in the Bioterium II of the FORP/USP and housed
in groups of two or three with circadian conditions
of 12 hours, constant temperature and humidity
(21 ± 1 °C and 55 to 75%, respectively) and
ad
libitum
access to water and a standard diet for
rodents (Labina Purina®/Agribrands do Brasil
LTDA, Paulínia, São Paulo, Brazil). The animals
were monitored throughout the pubertal period
and were euthanized after 56 days of life [2-4].
3
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
Nascimento CC et al.
Estrogen deficiency influences SEC23A gene expression in the odontogenic region of incisors – a murine model study
Nascimento CC et al. Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
Estrogen deciency model
Estrogen deficiency was caused by
ovariectomy surgery (Experimental group), and
the control group underwent ctitious surgery
(Control group). Briefly, when the animals
were 25 days old, they were anesthetized by
intraperitoneal injection of 10% ketamine
hydrochloride (55 mg/kg of gross body weight)
and 2% xylazine hydrochloride (10 mg/kg of
gross body weight). In the experimental group,
the ovaries were removed bilaterally; while in the
control group, a ctitious surgery was performed
without removing or damaging the ovaries of the
animals [2-4]. The success of the ovariectomy was
conrmed by the gradual increase in the weight of
the animals and uterine atrophy [2-4]. After the
surgical procedure, antibiotic, anti-inammatory
and analgesic medication was administered. The
drugs used were Benzylpenicillin Benzathine
(Pentabiotic®) at a dosage of 24,000UI/kg;
Flunixine (Aplonal® 1%) at a dosage of 1mg/kg,
both intramuscularly, and Tramadol (Cronidor®
2%), at a dosage of 1mg/kg, subcutaneously.
Tramadol is also administered again 24 hours
after the surgical procedure [2-4].
Euthanasia and preparation of specimens
Euthanasia was performed following the
guidelines of the National Council for the
Control of Animal Experimentation – CONCEA,
through anesthetic overdose with Ketamine
Hydrochloride (300mg/kg of weight) and
Xylazine Hydrochloride (30mg/kg of weight)
associated with decapitation [2-4].
Evaluation of the gene expression of AMDHD1,
CYP24A1, NADSYN1 and SEC23A in the odontogenic
region - RT-qPCR
To quantify the gene expression of AMDHD1,
CYP24A1, NADSYN1 and SEC23A differentially
expressed between experimental and control
groups, specimens were kept in RNAlater (Life
Technologies Corporation – Carlsbad®, Canada,
USA) and frozen at -80 °C until processing day. The
mirVana™ miRNA Isolation kit (Thermo Fischer
Scientic, Carlsbad, USA) was used to extract total
RNA. Complementary DNA (cDNA) was synthesized
by reverse-transcription with a Hight Capacity
Kit (Applied Biosystems, Foster City, CA, USA).
RT-qPCR was carried out on Mastercycler® ep
realplex-S thermocycler (Eppendorf AG, Hamburg,
Germany) for AMDHD1, CYP24A1, NADSYN and
SEC23A. PPIB was used as endogenous controls. The
relative levels of mRNA expression were determined
as previously described [19]. All procedures were
performed following the respective manufacturer’s
instructions and according to established protocols.
Primers are described in the Table I.
Statistical analysis
Data were statistically analyzed using
the GraphPad Prism 7.04 software (GraphPad
Software®, La Jolla, USA), considering a signicance
level of 5% (type I error). The gene expression of
AMDHD1, CYP24A, NADSYN1 and SEC23A is
demonstrated by means and standard deviation
(SD). Student’s t test was used to compare means.
The Kruskal-Wallis test and Dunn’s post-test were
also performed.
Figure 1 - Experimental design - chronology of procedures performed on animals.
Table I - Primers used for real-time quantitative polymerase chain reaction (RT-qPCR)
Gene symbol 5’-forward primer-3’ 5’-reverse primer-3’
AMDHD1 GCCTCTCTGCCACTTACTGTG GGCAGGTGGTGACTGATGATG
CYP24A1 GGCGGAAGACCTGAGGAATATG AGCGTATTCACCCAGAACCG
NADSYN TCCTTGCCTACCTGTTTGCTC GGTTGATGTCCGCACTGGAG
SEC23A GGATGGTGGTTGGAGATGAGC AGCAGCTCGATTAGCCAGTG
4
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
Nascimento CC et al.
Estrogen deficiency influences SEC23A gene expression in the odontogenic region of incisors – a murine model study
Nascimento CC et al. Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
RESULTS
The relative gene expression of AMDHD1,
CYP24A1, NADSYN1 and SEC23A in the
odontogenic region in estrogen-decient animals
(experimental group) and control animals
(control group) are shown in Figure 2. SEC23A
was overexpressed in estrogen deficiency
condition (p=0.021). AMDHD1, CYP24A1 and
NADSYN1 did not demonstrated statistical
difference between groups (p=0.47, p=0.21, and
p=0.95, respectively)
DISCUSSION
Estrogen is a crucial steroid hormone for both
female and male bodies [1]. Scientic evidence
demonstrates that imbalances in serum estrogen
levels inuence bone resorption, dyslipidemia,
glucose tolerance [20-22] and even vitamin D
absorption and metabolism [15]. Therefore, in the
present study we used a murine model to explore
the role of estrogen deciency on the expression
of the genes AMDHD1, CYP24A1, NADSYN1 and
SEC23A in the odontogenic region.
Vitamin D represents a group of fat-soluble
steroid hormones obtained through primary
exposure of the skin to UVB irradiation by
sunlight [9]. The 7-dehydrocholesterol present in
the skin is converted into pre-vitamin D3 [9,23], in
the liver, it is converted into 25-hydroxyvitamin D3
(25(OH)D3), the best serum indicator of vitamin
D status. In the kidney, 25(OH)D3 undergoes
hydroxylation and becomes 1,25-dihydroxy
vitamin D (1,25(OH)2D3), the biologically active
form that acts on VDR [23]. 80% to 90% of serum
levels of vitamin D are synthesized endogenously
under UVB irradiation, the remainder, 10% to
20%, come from the diet, the main dietary sources
being cholecalciferol (D3) and ergosterol (D2).
Estrogen deciency and vitamin D deciency share
several adverse health outcomes, including bone
resorption itself, mood disorders, increased risk of
cardiovascular disease and cancers [24-28] affect
growth and development [2-4,29-31].
The knowledge physiology and phenotypic
changes directly influence health promotion,
disease prevention, predisposition or protection
to diseases and drug response [32]. It is important
to clarify gaps that still exist in relation to
odontogenesis and tooth eruption process, which
are important to the harmonious development of
the stomatognathic system. Odontogenesis begins
approximately in the eighth week of gestation and
lasts, on mean, until the child’s full development,
around 18 years of age. This reminds us that,
although there is an individual chronology for
each tooth, odontogenesis occurs synchronously
with several important episodes in child growth
and development [33,34]. Concomitant to
specic periods of odontogenesis, tooth eruption
is also established.
Estrogen deficiency as well as vitamin
D deficiency have already been described as
inuencing odontogenesis and tooth eruption.
Based on a previous study by Madalena et al. [3]
the gene expression of the main estrogen receptors
in cells of the odontogenic region of teeth in
continuous growth was observed. Thus, in the
present study we investigated the influence
of estrogen deficiency on the expression of
genes related to the activation and degradation
of vitamin D in the odontogenic region of
continuously growing teeth in a murine model
in this same sample. Our results support that
Figure 2 - Relative gene expression (mRNA) of AMDHD1, CYP24A1, NADSYN1 and SEC23A in the odontogenic region of animals submitted to
estrogen deficiency compared with control animals. AMDHD1, CYP24A1 and NADSYN1 did not demonstrated statistical difference between
groups (p=0.47, p=0.21, and p=0.95, respectively). SEC23A was overexpressed in estrogen deficiency condition (p=0.021). * Indicates a
statistical significance difference (p<0.05).
5
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
Nascimento CC et al.
Estrogen deficiency influences SEC23A gene expression in the odontogenic region of incisors – a murine model study
Nascimento CC et al. Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
in estrogen deciency animals there was an
overexpression of SEC23A in the odontogenic
region of teeth in continuous growth. It is
important to emphasize that in the original
study from Madalena et al. [3] a delay in the
rate of tooth eruption in estrogen-deficient
animals.
It is therefore assumed that estrogen
deficiency could also cause occasional
overexpression of SEC23A since this gene is
also related to collagen alterations. Mutations
in SEC23A and AMDHD1 have been reported
to cause craniolenticulo-sutural dysplasia,
an anomaly characterized by craniofacial
and skeletal malformation due to defective
collagen secretion [35]. It is suggested that
there is a gross dilation of the endoplasmic
reticulum in broblasts from individuals with
such dysplasia [36]. SEC23A is an essential
component of vesicles that transport secretory
proteins from the endoplasmic reticulum, could
be overexpressed. In contrast, although there
was an overexpression of AMDHD1 in estrogen
deficiency, our results did not demonstrate
a statistically significant difference between
the groups. AMDHD1 gene overexpression is
suggested to actively participate in orthodontic
tooth movement, performed mainly by the
action of the periodontal ligament and bone
remodeling [37]. Thus, it is suggested that
other studies be carried out to complement the
evidence in a larger sample.
CYP24A1 catalyzes the conversion
of 25-hydroxyvitamin D3 (25(OH)D3) and
1,25-dihydroxyvitamin D3 (1,25(OH2)D3) into
24-hydroxylated products, which constitute the
degradation of the vitamin D molecule [38].
Although our results do not show a statistically
signicant difference between the experimental
and control groups, the experimental group
showed a decreased expression of CYP24A1,
suggesting a decrease in vitamin D synthesis,
transport, and degradation in the odontogenic
region of continuously growing teeth. Thus,
based on evidence from clinical studies that
demonstrate changes in development and tooth
eruption in vitamin D deciency and studies that
demonstrate a decrease in vitamin D in estrogen
deficiency, further studies are suggested to
complement the evidence.
Finally, we also found no statistically
signicant difference in NADSYN1 gene expression.
The NADSYN1 gene encodes nicotinamide
adenine dinucleotide synthetase 1, which is one
of the glutamine-dependent enzymes involved in
cholesterol synthesis and favors the production of
nicotinamide adenine dinucleotide (NAD+), the
main coenzyme required for energy production
and lipid synthesis. Genetic polymorphisms in
NADSYN1 have been described as contributing
to dyslipidemia and overweight regardless of
25-hydroxyvitamin D levels [39]. In conclusion,
our results contribute to evidence that seeks to
clarify physiological aspects of the role of estrogen
and vitamin D in the craniofacial complex.
CONCLUSION
Estrogen deficiency can influence the
expression of the SEC23A gene involved in the
activation and degradation of vitamin D in the
odontogenic region of incisor teeth in continuous
growth in a murine model.
Acknowledgements
We also thank to São Paulo Research
Foundation - FAPESP and the Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior –
CAPES/Brasil.
Author’s Contributions
CCN, MAS, MCP, MFRT: Writing – Original
Draft Preparation. AS, CK, CPL: Writing –
Review & Editing. PNF: Conceptualization.
FBF: Conceptualization, Methodology. ECK:
Conceptualization, Methodology, Funding
Acquisition. IRM: Methodology, Investigation,
Funding Acquisition.
Conict of Interest
The authors declare that they have no
conict of interest.
Funding
This research was funded by the São
Paulo Research Foundation - FAPESP (process
#2015/06866-5 and #2016/08149-1) and
Coordenação de Aperfeiçoamento de Pessoal de
Nível Superior (CAPES-Brasil) – PDPG-POSDOC/
Bolsa - CAPES nº 88887.755620/2022-00.
6
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
Nascimento CC et al.
Estrogen deficiency influences SEC23A gene expression in the odontogenic region of incisors – a murine model study
Nascimento CC et al. Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
Regulatory Statement
This study was conducted in accordance
with all the provisions of the local human
subjects oversight committee guidelines and
policies of: The Ethical Committee in Animal
Experimentation from the School of Dentistry of
Ribeirão Preto, University of São Paulo, Brazil.
The approval code for this study is: 2018.40.58.3.
REFERENCES
1. Patel S, Homaei A, Raju AB, Meher BR. Estrogen: the
necessary evil for human health, and ways to tame it.
Biomed Pharmacother. 2018;102:403-11. http://dx.doi.
org/10.1016/j.biopha.2018.03.078. PMid:29573619.
2. Madalena IR, Judachesci CS, Küchler EC, Nelson-Filho P, Ramazzotto
LA, Baratto-Filho F, et al. The impact of hypoestrogenism and
occlusal function on MMP1, MMP8 and MMP13 expression in the
odontogenic region in rats. RSDJournal. 2021;10(5):e47810515311.
http://dx.doi.org/10.33448/rsd-v10i5.15311.
3. Madalena IR, Marañón-Vásquez GA, Omori MA, Sousa ET,
Silveira HA, León JE,etal. Evaluation of tooth eruption rate of
incisor teeth in rats with estrogen deficiency. Clin Oral Investig.
2022;27(1):345-52. http://dx.doi.org/10.1007/s00784-022-
04738-w. PMid:36260168.
4. Anjos ID, Nogueira VO, Taranto MFR, Ramazzotto LA, Nelson-
Filho P, Küchler EC,etal. Estrogen deficiency influences TNF-α
and IL-1β gene expression in the odontogenic region of dental
hypofunctional condition. Braz Dent Sci. 2023;26(2):e3790.
http://dx.doi.org/10.4322/bds.2023.e3790.
5. Küchler EC, Meger MN, Ayumi Omori M, Gerber JT, Martins
EC No, Machado NCS,etal. Association between oestrogen
receptors and female temporomandibular disorders. Acta
Odontol Scand. 2020;78(3):181-8. http://dx.doi.org/10.1080/
00016357.2019.1675904. PMid:31646926.
6. Omori MA, Marañón-Vásquez GA, Romualdo PC, Martins EC
No, Stuani MBS, Matsumoto MN,etal. Effect of ovariectomy
on maxilla and mandible dimensions of female rats. Orthod
Craniofac Res. 2020;23(3):342-50. http://dx.doi.org/10.1111/
ocr.12376. PMid:32246880.
7. Küchler EC, Lara RM, Omori MA, Schröder A, Teodoro VB,
Baratto-Filho F,etal. Estrogen deficiency affects tooth formation
and gene expression in the odontogenic region of female
rats. Ann Anat. 2021;236:151702. http://dx.doi.org/10.1016/j.
aanat.2021.151702. PMid:33607226.
8. Xavier TA, Madalena IR, Silva RAB, Silva LAB, Silva MJB, Rossi
A,etal. Vitamin D deficiency is a risk factor for delayed tooth
eruption associated with persistent primary tooth. Acta Odontol
Scand. 2021;79(8):600-5. http://dx.doi.org/10.1080/00016357
.2021.1918762. PMid:33944665.
9. Bikle DD. Vitamin D metabolism, mechanism of action, and
clinical applications. Chem Biol. 2014;21(3):319-29. http://dx.doi.
org/10.1016/j.chembiol.2013.12.016. PMid:24529992.
10. Freitas AT, Calhau C, Antunes G, Araújo B, Bandeira M, Barreira
S, et al. Vitamin D-related polymorphisms and vitamin D
levels as risk biomarkers of COVID-19 disease severity. Sci
Rep. 2021;11(1):20837. http://dx.doi.org/10.1038/s41598-021-
99952-z. PMid:34675344.
11. Küchler EC, Reis CLB, Marañón-Vásquez G, Nelson-Filho P,
Matsumoto MAN, Stuani MBS,etal. Parathyroid hormone gene and
genes involved in the maintenance of vitamin D levels association
with mandibular retrognathism. J Pers Med. 2021;11(5):369.
http://dx.doi.org/10.3390/jpm11050369. PMid:34063310.
12. Scardina GA, Messina P. Good oral health and diet.
J Biomed Biotechnol. 2012;2012:720692. http://dx.doi.
org/10.1155/2012/720692. PMid:22363174.
13. Uwitonze AM, Murererehe J, Ineza MC, Harelimana EI, Nsabimana
U, Uwambaye P,etal. Effects of vitamin D status on oral health.
J Steroid Biochem Mol Biol. 2018;175:190-4. http://dx.doi.
org/10.1016/j.jsbmb.2017.01.020. PMid:28161532.
14. Kinuta K, Tanaka H, Moriwake T, Aya K, Kato S, Seino Y. Vitamin
D is an important factor in estrogen biosynthesis of both
female and male gonads. Endocrinology. 2000;141(4):1317-24.
http://dx.doi.org/10.1210/endo.141.4.7403. PMid:10746634.
15. Welsh J, Wietzke JA, Zinser GM, Byrne B, Smith K, Narvaez
CJ. Vitamin D-3 receptor as a target for breast cancer
prevention. J Nutr. 2003;133(7, Suppl):2425S-33S. http://dx.doi.
org/10.1093/jn/133.7.2425S. PMid:12840219.
16. Li C, Cui Y, Zhou C, Sun J, Zhou X. Epigenetics in odontogenesis
and its influences. Curr Stem Cell Res Ther. 2018;13(2):110-7.
http://dx.doi.org/10.2174/1574888X12666170530100524.
PMid:28554314.
17. Berdal A, Balmain N, Cuisinier-Gleizes P, Mathieu H.
Histology and microradiography of early post-natal molar
tooth development in vitamin-D deficient rats. Arch Oral
Biol. 1987;32(7):493-8. http://dx.doi.org/10.1016/S0003-
9969(87)80010-9. PMid:3479087.
18. Kilkenny C, Browne WJ, Cuthill IC, Emerson M, Altman DG.
Improving bioscience research reporting: the ARRIVE guidelines
for reporting animal research. PLoS Biol. 2010;8(6):e1000412.
http://dx.doi.org/10.1371/journal.pbio.1000412. PMid:20613859.
19. Nazet U, Schröder A, Grässel S, Muschter D, Proff P, Kirschneck
C. Housekeeping gene validation for RT-qPCR studies on
synovial fibroblasts derived from healthy and osteoarthritic
patients with focus on mechanical loading. PLoS One.
2019;14(12):e0225790. http://dx.doi.org/10.1371/journal.
pone.0225790. PMid:31809510.
20. Manolagas SC, O’Brien CA, Almeida M. The role of estrogen
and androgen receptors in bone health and disease. Nat Rev
Endocrinol. 2013;9(12):699-712. http://dx.doi.org/10.1038/
nrendo.2013.179. PMid:24042328.
21. Alemany M. Estrogens and the regulation of glucose
metabolism. World J Diabetes. 2021;12(10):1622-54.
http://dx.doi.org/10.4239/wjd.v12.i10.1622. PMid:34754368.
22. Torosyan N, Visrodia P, Torbati T, Minissian MB, Shufelt CL.
Dyslipidemia in midlife women: approach and considerations
during the menopausal transition. Maturitas. 2022;166:14-20.
http://dx.doi.org/10.1016/j.maturitas.2022.08.001.
PMid:36027726.
23. Braegger C, Campoy C, Colomb V, Decsi T, Domellof M, Fewtrell
M,etal. Vitamin D in the healthy European paediatric population.
J Pediatr Gastroenterol Nutr. 2013;56(6):692-701. http://dx.doi.
org/10.1097/MPG.0b013e31828f3c05. PMid:23708639.
24. Schmitt EB, Nahas-Neto J, Bueloni-Dias F, Poloni PF, Orsatti CL,
Nahas EAP. Vitamin D deficiency is associated with metabolic
syndrome in postmenopausal women. Maturitas. 2018;107:97-
102. http://dx.doi.org/10.1016/j.maturitas.2017.10.011.
PMid:29169589.
25. Kwak JH, Hong YC, Choi YH. Serum 25-hydroxyvitamin D and
hypertension in premenopausal and postmenopausal women:
National Health and Nutrition Examination Surveys 2007-
2010. Public Health Nutr. 2020;23(7):1236-46. http://dx.doi.
org/10.1017/S1368980019003665. PMid:31948509.
26. Nepal AK, van Essen HW, van der Veen AJ, van Wieringen WN,
Stavenuiter AWD, Cayami FK,etal. Mechanical stress regulates
bone regulatory gene expression independent of estrogen and
vitamin D deficiency in rats. J Orthop Res. 2021;39(1):42-52.
http://dx.doi.org/10.1002/jor.24775. PMid:32530517.
7
Braz Dent Sci 2024 Jan/Mar; 27 (1): e3827
Nascimento CC et al.
Estrogen deficiency influences SEC23A gene expression in the odontogenic region of incisors – a murine model study
Nascimento CC et al. Estrogen deficiency influences SEC23A gene expression in the
odontogenic region of incisors – a murine model study
27. Amini S, Amani R, Jafarirad S, Cheraghian B, Sayyah
M, Hemmati AA. The effect of vitamin D and calcium
supplementation on inflammatory biomarkers, estradiol
levels and severity of symptoms in women with postpartum
depression: a randomized double-blind clinical trial. Nutr
Neurosci. 2022;25(1):22-32. http://dx.doi.org/10.1080/1028
415X.2019.1707396. PMid:31900080.
28. Sire A, Gallelli L, Marotta N, Lippi L, Fusco N, Calafiore D,etal.
Vitamin D deficiency in women with breast cancer: a correlation
with osteoporosis? A machine learning approach with multiple
factor analysis. Nutrients. 2022;14(8):1586. http://dx.doi.
org/10.3390/nu14081586. PMid:35458148.
29. Küchler EC, Lara RM, Omori MA, Marañón-Vásquez G, Baratto-
Filho F, Nelson-Filho P,etal. Effects of estrogen deficiency during
puberty on maxillary and mandibular growth and associated
gene expression: an μCT study on rats. Head Face Med.
2021;17(1):14. http://dx.doi.org/10.1186/s13005-021-00265-3.
PMid:33888144.
30. Bergamo AZN, Madalena IR, Omori MA, Ramazzotto LA, Nelson-
Filho P, Baratto-Filho F,etal. Estrogen deficiency during puberty
affects the expression of microRNA30a and microRNA503 in the
mandibular condyle. Ann Anat. 2022;240:151865. http://dx.doi.
org/10.1016/j.aanat.2021.151865. PMid:34813926.
31. Küchler EC, Carelli J, Morais ND, Brancher JA, Lopes CMCF,
Baratto-Filho F,et al. Assessing the association between
vitamin D receptor and dental age variability. Clin Oral Investig.
2022;26(2):1677-82. http://dx.doi.org/10.1007/s00784-021-
04140-y. PMid:34463798.
32. Jin Y, Wang J, Bachtiar M, Chong SS, Lee CG. Architecture
of polymorphisms in the human genome reveals functionally
important and positively selected variants in immune
response and drug transporter genes. Hum Genomics.
2018;12(1):43. http://dx.doi.org/10.1186/s40246-018-0175-1.
PMid:30219098.
33. Bittencourt MV, Cericato GO, Franco A, Girão RS, Lima APB,
Paranhos LR. Accuracy of dental development for estimating the
pubertal growth spurt in comparison to skeletal development:
a systematic review and meta-analysis. Dentomaxillofac Radiol.
2017;47(4):20170362. http://dx.doi.org/10.1259/dmfr.20170362.
PMid:29241366.
34. Miyazaki A, Sugimoto A, Yoshizaki K, Kawarabayashi K, Iwata K,
Kurogoushi R,etal. Coordination of WNT signaling and ciliogenesis
during odontogenesis by piezo type mechanosensitive ion
channel component 1. Sci Rep. 2019;9(1):14762. http://dx.doi.
org/10.1038/s41598-019-51381-9. PMid:31611621.
35. Jiang X, Kiel DP, Kraft P. The genetics of vitamin D. Bone.
2019;126:59-77. http://dx.doi.org/10.1016/j.bone.2018.10.006.
PMid:30316967.
36. Boyadjiev SA, Fromme JC, Ben J, Chong SS, Nauta C, Hur
DJ, et al. Cranio-lenticulo-sutural dysplasia is caused by a
SEC23A mutation leading to abnormal endoplasmic-reticulum-
to-Golgi trafficking. Nat Genet. 2006;38(10):1192-7. http://
dx.doi.org/10.1038/ng1876. PMid:16980979.
37. Küchler EC, Schröder A, Teodoro VB, Nazet U, Scariot R, Spanier
G,etal. The role of 25-hydroxyvitamin-D3 and vitamin D receptor
gene in human periodontal ligament fibroblasts as response
to orthodontic compressive strain: an in vitro study. BMC Oral
Health. 2021;21(1):386. http://dx.doi.org/10.1186/s12903-021-
01740-8. PMid:34362362.
38. Jones G, Prosser DE, Kaufmann M. 25-Hydroxyvitamin D-24-
hydroxylase (CYP24A1): its important role in the degradation
of vitamin D. Arch Biochem Biophys. 2012;523(1):9-18. http://
dx.doi.org/10.1016/j.abb.2011.11.003. PMid:22100522.
39. Foucan L, Vélayoudom-Céphise FL, Larifla L, Armand C,
Deloumeaux J, Fagour C,etal. Polymorphisms in GC and NADSYN1
Genes are associated with vitamin D status and metabolic profile
in Non-diabetic adults. BMC Endocr Disord. 2013;13(1):36.
http://dx.doi.org/10.1186/1472-6823-13-36. PMid:24073860.
Isabela Ribeiro Madalena
(Corresponding address)
Centro Universitário Presidente Tancredo de Almeida Neves, Faculdade de Odontologia,
São João del Rei, MG, Brazil.
Email: isabelarmadalena@hotmail.com Date submitted: 2023 Mar 09
Accept submission: 2024 Jan 17