UNIVERSIDADE ESTADUAL PAULISTA
“JÚLIO DE MESQUITA FILHO”
Instituto de Ciência e Tecnologia
Campus de São José dos Campos
ORIGINAL ARTICLE DOI: https://doi.org/10.4322/bds.2024.e4172
1
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Therapeutic potential of sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Potencial terapêutico do sulforafano: modulação do NRF-2 mediado o pela via PI3/AKT/mTOR na fibrose oral
Pooja Narain ADTANI1 , Rajasekaran SUBBARAYAN2 , Rupendra SHRESTHA3 , Walid ELSAYED1
1 - Gulf Medical University, College of Dentistry, Department of Basic Medical and Dental Sciences. Ajman, United Arab Emirates.
2 - Chettinad Academy of Research and Education, Chettinad Hospital and Research Institute, Faculty of Allied Health Sciences, Center
for Advanced Biotherapeutics and Regenerative Medicine. Chennai, India.
3 - Anka Analytica, Research and Collaboration. Melbourne, Victoria, Australia.
How to cite: Adtani PN, Subbarayan R, Shrestha R, Elsayed W. Therapeutic potential of sulforaphane: modulation of NRF2-mediated
PI3/AKT/mTOR pathway in oral brosis. Braz Dent Sci. 2024;27(1):e4172. https://doi.org/10.4322/bds.2024.e4172
ABSTRACT
Oral Submucous Fibrosis is a potentially malignant disorder caused by habitual areca nut chewing, which
contributes to the dispersion of active alkaloids into subepithelial tissues, stimulating excessive extracellular
matrix deposition. Various treatment modalities are available; however, their efcacy in inhibiting brosis
progression remains limited. Sulforaphane (SFN), an isothiocyanate found abundantly in cruciferous plants, is
known to have effective antibrotic properties. Objective: The present study investigated the antibrotic effect
of SFN via phosphatidylinositol 3 kinase (PI3K), Serine/Threonine Kinase 1 (AKT-1), mammalian target of
rapamycin (mTOR) pathway in arecoline (AER) induced brosis in human gingival broblasts [HGFs]. Material
and Methods: MTT assay determined the half-maximal inhibitory concentration of AER and SFN at 24h in the
HGF cell line. Expression levels of transforming growth factor β1 (TGFβ1), collagen type 1 alpha 2 (COL1A2),
hydroxyproline (HYP), PI3, AKT, mTOR, and nuclear factor erythroid 2–related factor 2 (NRF2) were assessed
post-AER and SFN treatment using qPCR and western blot analysis. Results: The ndings of the study revealed that
AER elicited a stimulatory effect, upregulating TGFβ1, COL1A2, HYP, PI3K, AKT, and mTOR and downregulating
NRF2 expression. Conversely, SFN treatment signicantly upregulated NRF2, inhibiting TGFβ1 mediated PI3/
AKT/mTOR pathway. Conclusion: These observations suggest that SFN can be used as a promising synergistic
antibrotic agent to combat brogenesis via the non-Smad pathway.
KEYWORDS
Arecoline; NRF2; Oral submucous brosis; PI3/AKT/mTOR; Sulforaphane.
RESUMO
Fibrose submucosa oral é uma desordem potencialmente maligna causada pelo habito de mascar a noz da areca,
o que contribui para a dispersão de alcalóides ativos nos tecidos subepiteliais, estimulando a deposição excessiva
de matriz extracelular. Há várias modalidades terapêuticas, no entanto, com ecácia limitada no controle da
progressão da brose. O sulforafano (SFN), isotiocianato encontrado abundantemente em plantas crucíferas,
é conhecido por suas propriedades antibróticas. Objetivo: Investigar os efeitos antibróticos do SFN na via
fosfatidilinositol3-quinase (PI3K), via quinase serina/treonina 1 (AKT-1), via do alvo da rapamicina em mamíferos
(mTOR), na brose induzida por arecolina (AER) em broblastos gengivais de humanos (HGFs). Material e
Métodos: A meia concentração inibitória mínima de AER e SFN em 24 horas nas células HGFs foi determinada
por MTT. Os níveis de expressão de β1 (TGFβ1), colágeno tipo 1 alfa 2 (COL1A2), hidroxiprolina (HYP), PI3K,
AKT, mTOR, fator nuclear eritroide 2 relacionado ao fator 2 (NRF2) foram analisados após tratamento com ERA e
SFN através de qPCR e western blot. Resultados: O ERA apresentou efeito estimulatório aumentando a expressão
de TGFβ1, COL1A2, HYP, PI3K, AKT e mTOR e diminuindo a expressão de NRF2. Por outro lado, tratamento
2
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
INTRODUCTION
Oral submucous brosis (OSF) is a chronic,
progressive, and insidious collagen metabolic
disorder that affects several parts of the oral
cavity [1]. According to the World Health
Organization (WHO) report in 2022, OSF has a
global prevalence of 4.96%, with most cases in
Southeast Asian countries such as India, Pakistan,
Bangladesh, China, Taiwan, and Vietnam [2].
OSF has a multifactorial etiopathogenesis, such
as genetic predisposition, autoimmunity, and
vitamin deciency, but the primary causative
agent is arecanut or betelnut chewing [3]. One of
the essential constituents of the arecanut fruit is
the presence of an alkaloid arecoline (AER) which
is hydrolyzed to arecaidine on reacting with
lime. Both AER and arecaidine are carcinogenic
and mutagenic, contributing to the malignant
transformation of OSF to Oral Squamous Cell
Carcinoma (OSCC) [1,4,5]. OSFs worldwide
malignant transformation rate is estimated to
be 1.2% to 23% and is classied as a potentially
malignant disorder [6,7].
Several in vitro and clinical studies
have reported AER-induced upregulation of
transforming growth factor-beta 1 (TGFβ1)/Smad
signaling, collagen type 1 alpha 2 (COL1A2),
collagen type 3 alpha 1 (COL3A1), beta broblast
growth factor (bFGF), connective tissue growth
factor (CTGF), alpha-smooth muscle actin
(αSMA), reactive oxygen species, tumor necrosis
factor-alpha (TNFα), matrix metalloproteinases,
and downregulation of tissue inhibitors of
metalloproteinases [6,8-10]. A few studies have
also demonstrated the inducive effect of AER
on HepG2 cells, promoting proliferation and
migration of cells through the activation of the
phosphoinositide 3-kinase/ /mammalian target
of rapamycin (PI3/AKT/mTOR) pathway [11].
The PI3/AKT/mTOR has also been explored
in brotic conditions such as idiopathic pulmonary
brosis and liver brosis [12,13]. PI3/AKT/mTOR
is an important intracellular signaling transduction
pathway for cell survival, proliferation, apoptosis,
and autophagy. Autophagy is a fascinating
cellular process that enables cells to withstand
various stresses and rid themselves of detrimental
components [14]. Furthermore, inhibition of the
mTOR signaling pathway is associated with the
induction of autophagy primarily modulated by
a master transcription factor called NF-E2-related
Factor 2 (NRF2) [14-16].
The existing treatment modalities for OSF only
provide temporary symptomatic relief as recurrence
of the fibrotic bands is a common side effect
observed after surgical interventions, highlighting
the need for an effective intervention [17,18].
Therefore, developing antibrotic approaches to
attenuate oral brosis becomes a vital objective
to prevent the malignant transformation of
OSF. Sulforaphane (SFN) is a sulfur-containing
isothiocyanate found abundantly in cruciferous
vegetables such as cabbage, brussels sprouts, and
broccoli. Several studies have reported SFN as a
chemo-preventive agent functioning via NRF2-
dependent induction of phase II detoxifying
enzymes. Recent investigations suggest that
the chemo-preventive effect of SFN is mediated
through various mechanisms; for example, in
breast and prostate cancer cell lines, it suppresses
mTOR activity and induces autophagy. It is also
known to cause cell cycle arrest, promote apoptosis,
and inhibit angiogenesis and metastasis [19-21].
Additionally, SFN has demonstrated promising
antibrotic activity in renal brosis and pulmonary
brosis in an NRF 2-dependent manner [22,23].
However, the potential effects of SFN in OSF and
its impact on the probrotic TGFβ1 mediated PI3/
AKT/mTOR pathway have not yet been assessed.
Therefore, our study investigated the antibrotic
effect of SFN treatment in attenuating arecoline-
induced fibrosis in human gingival fibroblasts
[HGFs] via the PI3/AKT/mTOR pathway.
com SFN aumentou signicativamente a expressão de NRF2, inibindo a liberação de TGFβ1 mediada pela via
PI3/AKT/mTOR. Conclusão: Esses achados sugerem que o SFN pode ser um agente antibrótico promissor no
combate à brogênese decorrente da via não-Smad.
PALAVRAS-CHAVE
Arecolina; NRF2; Fibrose submucosa oral; PI3/AKT/mTOR; Sulforafano.
3
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
MATERIAL AND METHODS
Chemicals and consumables
All the cell culture plasticware and chemicals
were purchased from Thermosher Scientic,
Mumbai, India, and Lonza, Basel, Switzerland.
The kits were purchased from Sigma Aldrich,
Missouri, USA. qPCR products, Verso cDNA
Synthesis Kit from Thermofisher Scientific,
Mumbai, India, and primers were purchased
from Eurons, Bangalore, India. Chemicals and
materials for protein analysis were procured from
Bio-Rad, CA, USA. All antibodies were purchased
from Abcam, (Cambridge, UK, and Cell Signaling,
Massachusetts, USA. D, L-Sulforaphane (CAS
number – 4478937) and Arecoline hydrobromide
(CAS number – 300083) were purchased from
Sigma Aldrich, Missouri, USA.
Human gingival broblast cell culture
Primary Gingival Fibroblast Human adult
cells (HGF) were obtained from the American
Type Culture Collection (ATCC - PCS-201-
018). Cell suspensions were centrifuged at
1000 g for 5 min at 37°C; the obtained pellet
was resuspended in complete media and seeded
in 6 well plates containing complete media.
HGFs were distributed evenly into a T75 ask
in complete Dulbecco’s Modied Eagle Medium
(DMEM) Low Glucose (Lonza) supplemented
with 10% Fetal Bovine Serum (Invitrogen),
100 U/mL penicillin, 100 µg/mL streptomycin,
100 µg/mL amphotericin B, 2 mM L-Glutamine
and cultured at 37°C, 5% CO2 in humidified
tissue culture incubator. Growth media was
changed every third day. The plastic adherent
conuent cells were passaged with 0.05% trypsin
containing 1mM Ethylenediaminetetraacetic Acid
(EDTA) [24]. Cells from the 5th-6th passages were
used for the experiments.
Cell viability and proliferation assay
MTT (3-(4, 5-dimethyl thiazol-2yl)-2,
5-diphenyl tetrazolium bromide) assay was
performed to determine the viability and cell
proliferation rate of HGFs by colorimetric
estimation [25,26]. Cultured HGFs were treated
with various concentrations of SFN (1µM,
5µM, 10µM, 25µM, 50µM, 80µM, 100µM), and
AER (0.0025 µg/mL, 0.25 µg/mL, 2.5 µg/mL,
25 µg/mL, 50 µg/mL, 100µg/mL) for 24h and
48h respectively [8,27]. SFN was dissolved
in 1X phosphate buffered saline and AER in
dimethyl sulfoxide (DMSO). Next, 20 µL of the
MTT solution was thoroughly mixed in each
well. The supernatants were aspirated after 4h
of incubation, and 100 µL of DMSO was added
to each well to dissolve the residue. Cell viability
was estimated by measuring the absorbance
at 570 nm in the IQuant ELISA plate reader,
Vermont, USA. The cell viability percentage was
determined by analyzing the absorbance ratio
of cell cultures treated with SFN and AER. Cell
viability expressed as a percentage of the control
is determined by multiplying the untreated
control by 100. After repeated SFN and AER
dilutions, 50% cell death was used to calculate
the cytotoxicity (IC50) ratio.
Immuno-cytochemistry analysis of vimentin
and TGFβ1
HGFs were cultured and induced with AER.
After induction, HGFs were treated with SFN
for 24h and xed with 10% formalin for 30 min
and ice-cold methanol for 20 min to promote
permeabilization. Immunouorescence staining
was performed for anti-vimentin (Abcam –
ab137321) to conrm the phenotypic properties
of fibroblasts. 4′,6-diamidino-2-phenylindole
(DAPI) staining was performed to counterstain
the nucleus. Images were captured at 20X
magnification. Further, immunostaining was
performed for anti-TGFβ1 (Abcam - ab9758) and
secondary antibody (Goat anti-Rabbit IgG Alexa
Fluor 488 (A32731) along with DAPI to conrm
the brotic properties. Six different regions on
the coverslip were focused, and images were
recorded at 40X magnication. The uorescence
intensity was estimated using FIJI software, and
the expression pattern of TGFβ1 was quantied
(Arbitrary Units).
Hydroxyproline estimation by colorimetric
method
For hydroxyproline (HYP) estimation, cells
were scraped out with 100 µL of water post 24h
SFN treatment and transferred to a pressure-
tight polypropylene vial with a poly tetrauoro
ethylene lined cap as per the manufacturer’s
protocol (Sigma-Aldrich, Cat no MAK008).
100 µL of concentrated hydrochloric acid (HCl,
∼12 M) was added and capped tightly, followed
by hydrolyses at 120°C for 3h. The contents
were mixed and centrifuged at 10,000 rpm for
3 min, of which 10 - 50 µL of supernatant was
4
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
transferred to a 96-well plate. HYP in the sample
was detected using a multiple spectrometer (Bio-
Rad, Hercules, CA, USA) at 560 nm.
RNA extraction and Quantitative Polymerase
Chain Reaction (qPCR) analysis
RNA Isolation
According to the manufacturer’s protocol,
the TRIzol® method was used to extract total
RNA of cell after 24h post SFN treatments.
Synthesis of Complementary DNA (cDNA)
Following the instructions provided by the
manufacturer, the PrimeScript RT Master Mix
(Takara Bio, Kusatsu, Japan) was utilized for
cDNA synthesis. For each cDNA synthesis, 1 µg
RNA was combined with 4 µL of 5X PrimeScript
RT Master Mix and diluted to a final volume
of 20 µL using RNAse-free ddH2O from Takara
Bio. A reverse transcription step of 15 min at
37°C, followed by a 5 s inactivation step at 85°C,
and a holding temperature at 4°C were set on
the Thermocycler T100 (Bio‐Rad Laboratories,
Hercules, CA, USA). The cDNA samples were
promptly stored at -20°C. Experiment was
conducted (qPCR) using power SYBR Green
Master Mix to verify the amplication from the
cDNA templates on a Quanta Studio 7 ex. An
evaluation of the assay specicity for each gene
of interest was conducted through melting curve
analysis. A singular peak in the analysis indicates
primer specicity. The present study investigated
the genes related to brosis and receptor specic
for SFN; TGFβ1, COL1A2, P13K, AKT, mTOR,
and NRF2 in all the experimental samples.
All reactions were performed in triplicates.
Primers were designed using previously reported
methods [28]. The primer pair specicity was
confirmed using the Primer-Blast tool and
purchased from Eurons Scientic, India. The
primer sequences and accession numbers are
listed in Table I. The protocol for RNA isolation,
cDNA retro-transcription and amplication was
standardized by the authors [28].
Western blot analysis
HGFs were subjected to 25 µg/mL of AER
to induce a fibrotic condition [9] following
which the cells received SFN treatment at a
concentration of 10 µM. After 24h treatment,
the proteins were extracted using RIPA Cell Lysis
Buffer and carefully stored on ice for 30 min. The
lysates were centrifuged at a speed of 12,000 g
at a temperature of 4°C for 10 min. Later, the
resulting liquid was carefully transferred to a
new tube. Using the bicinchoninic acid (BCA)
method, protein samples of 40 µg/lane were
separated using SDS-PAGE and transferred
into polyvinylidene fluoride membranes. A
solution containing 10% bovine serum albumin
(BSA) was utilized to block the membranes
for one hour at room temperature. Next, the
membranes were exposed to TGFβ1 (Abcam -
ab9758), NRF2 (Abcam - ab62352), p-mTOR
(Abcam -ab109268), mTOR (Abcam – ab137133),
and β-Actin (Abcam - ab8226) antibodies. Then,
the membranes were washed thrice and probed
with secondary antibodies (Goat anti-Rabbit IgG
Alexa Fluor 488 (A32731). The detection was
performed using enhanced chemiluminescence
reagents from Pierce, Rockford, IL, USA. The
intensities of the generated bands were measured
using ImageJ software.
Statistical analysis
The assessed values are the mean ± standard
error of the experimental samples, which include
the control, AER treated, and AER with SFN
treated, with n (3) biological triplicates. Statistical
Table I - Primer sequences and accession numbers.
Human Specific Gene Forward Sequence Reverse Sequence Accession No
TGFβ1 TACCTGAACCCGTGTTGCTCTC GTTGCTGAGGTATCGCCAGGAA NM 000660
COL1A2 CCTGGTGCTAAAGGAGAAAGAGG ATCACCACGACTTCCAGCAGGA NM 000089
PI3K GAAGCACCTGAATAGGCAAGTCG GAGCATCCATGAAATCTGGTCGC NM 006218
mTOR AGCATCGGATGCTTAGGAGTGG CAGCCAGTCATCTTTGGAGACC NM 004958
AKT TGGACTACCTGCACTCGGAGAA GTGCCGCAAAAGGTCTTCATGG NM 005163
NRF2 CACATCCAGTCAGAAACCAGTGG GGAATGTCTGCGCCAAAAGCTG NM 006164
TBP TGTATCCACAGTGAATCTTGGTTG GGTTCGTGGCTCTCTTATCCTC NM 003194
5
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
analysis was conducted using One-way ANOVA
and a Bonferroni post hoc multiple comparison
test, which provided a 95% confidence level.
Using Graph Pad Prism 10.0, the intervals
**p= <0.001 and *p= 0.05 were determined.
RESULTS
Cytotoxic effects of SFN and AER on HGFs
The initial findings of SFN and AER on
HGFs showed that the level of cytotoxicity
increased in a dose-dependent manner. Based
on the MTT assay, it was observed that over
50% of the cells remained viable after 24h of
incubation with SFN and AER, as shown in
(Figures 1a and 1d). The results obtained were
satisfactory. With increasing doses of as high
as 100 µM of SFN and 100 µg/mL of AER per
culture (Figures 1a and 1d), HGFs showed
signicantly reduced cell growth compared with
the minimal concentration of SFN (1 µM) and
AER (0.0025 µg/mL). Based on the data obtained
from Figures 1a-f, it was determined that SFN
had an inhibitory effect on cell growth of HGFs
at a concentration 11.48 µM, while AER exhibited
the same effect at a concentration of 25 µg/mL.
To calibrate the experiment, a concentration of
10 µM of SFN was utilized for the subsequent
procedures.
Immunouorescence analysis of HGFs using
TGFβ1 and vimentin staining
Immunouorescence staining with vimentin
confirmed the spindle-shaped fibroblastic
morphology and the mesenchymal origin of
HGFs [29]. The nucleus of the cells was stained
with DAPI (Figure 2a). Induction of AER in
HGFs showed a signicant increase in TGFβ1
expression. However, after 24h of SFN treatment,
a substantial reduction in TGFβ1 expression was
observed (Figure 2b). Furthermore, uorescent
intensity was quantied at a minimum of 6 elds
of 10X magnification, corroborating with the
captured image in Figure 2c.
Effect of SFN on Hydroxyproline levels in
AER-treated HGFs
We also confirmed the soluble collagen
deposition by measuring the hydroxyproline
(HYP) levels. The induced group (AER) showed
signicantly increased expression compared to the
control. Interestingly, SFN treatment signicantly
reduced and regulated the development of brosis
induced in the HGF cell model (Figure 2d).
Figure 1 - Graphical representation of cytotoxic effects of Sulforaphane (SFN) and Arecoline (AER) on Human Gingival Fibroblast (HGF) cells
on 24h and 48h treatment. (a) Percentage of cell viability on treatment with different concentrations of SFN; (b) Half maximal inhibitory (IC50)
for SFN was determined as 11.48 µM at 24h; (c) Half maximal inhibitory (IC50) for SFN was determined as 11.10 µM at 48h; (e) Half maximal
inhibitory (IC50) for AER was determined as 25 µg/mL at 24h; (f) Half maximal inhibitory (IC50) for AER was determined as 26.12 µg/mL at
48h. IC50 concentrations observed at 24h for SFN and AER were used for the study.
6
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Effect of SFN on TGFβ1 mediated PI3/AKT/
mTOR
The mRNA analysis showed that the
expression of crucial brotic markers (TGFβ1 and
COL1A2) signicantly increased in AER-treated
cells compared to the control. On SFN treatment,
a significant downregulation of the fibrotic
markers was observed (Figures 3a and 3b). P13K,
AKT, and mTOR expression on AER induction
(25 µg/mL) significantly increased compared
to the control group (Figures 3c, 3d and 3e).
However, SFN (10 µM) treatment signicantly
reduced fibrosis in the induced HGF cells. In
addition, our study results demonstrated that
the expression levels of NRF2, an SFN-specic
binding protein, were signicantly reduced after
AER induction. On the contrary, SFN treatment
significantly upregulated NRF2 levels and
conrmed that the antibrotic effect of SFN is
mediated via NRF2 (Figure 3f). The gene fold
changes were calculated using ∆Ct, and all
gene expressions were normalized with TBP.
The illustration of gene expression represents
a heat map, which elucidates the gene cluster
orientation of the targeted gene (Figure 3g).
Furthermore, the protein analysis conrmed
that the functional aspects of SFN treatment
signicantly reduced TGFβ1 and increased NRF2
expression following AER induction (Figure 4a).
SFN treatment signicantly reduced mTOR levels
in the AER-induced HGFs (Figure 4c). Relative
units were calculated from the densitometry
value and normalized with β-actin (Figure 4b).
mTOR levels were computed using p-mTOR/t-
mTOR densitometry values (Figure 4d). All
experiments were performed with at least n (3)
biological replicates.
DISCUSSION
Despite the availability of various treatment
options for OSF, the reappearance of fibrotic
Figure 2 - Immunofluorescence staining of Human Gingival Fibroblasts (HGFs) (a) [Left to right in the panel] - Phase contrast image, nucleus
stained with DAPI, vimentin staining confirming the mesenchymal origin, and merged image (DAPI/Vimentin) (b) Comparison between control,
AER treated, and AER and SFN treated group on staining with TGβ1 and DAPI; (c) Graphical representation of fluorescent intensity quantification
of a minimum 6 field of 10X magnification; (d) Graphic representation of hydroxyproline estimation on AER treatment and post-SFN treatment.
**p<0.01, *p<0.05
7
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Figure 3 - Comparative analysis of mRNA expression in HGFs by quantitative polymerase chain reaction assay (a-f) Graphical representation
showing a comparison of mRNA expression of TGFβ1, COL1A2, PI3K, AKT-1, mTOR, and NRF2 normalized with TBP. Experimental triplicates
were performed. The results were analyzed using a relative quantification (RQ) manager, and CT values were obtained from the percentage of
relative expression with normalization using TBP (n=3). Analysis of variance (*p = <0.05, **p = <0.01) was considered statistically significant. (g)
SRplot was used to create the heat map and show the gene cluster orientation of the targeted genes analyzed in this study.
Figure 4 - Comparative analysis of protein expression in HGFs by western blot assay (a) Protein expression analysis of TGFβ1, NRF2 and β-actin
served as the loading control for the respective Control, SFN, AER, SFN/AER; (b) Graphical representation comparing the expression of TGFβ1
and NRF2 normalized with β-actin; (c) Protein expression analysis was conducted for p-mTOR and t-mTOR in the Control, SFN, AER and SFN/
AER; (d) The graph illustrates the normalized levels of relative p-mTOR vs t-mTOR (n=3). The analysis of variance showed statistical significance
with a p-value (*p = <0.05).
8
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
bands is frequent [30]. Incorporating a potent
phytomedicine-based supplementary therapy
could improve the predictive results. As reported in
studies, SFN is a natural isothiocyanate known for
its antibacterial, anti-helminthic, anti-inammatory,
antibrotic, and antitumorigenic properties. The
effectiveness of SFN in combating brosis has been
investigated in conditions like idiopathic pulmonary
brosis and liver brosis [19,23,31].
In the present study, we demonstrated
that treatment with 25 µg/mL of AER in HGFs
significantly upregulated the expression of
profibrotic growth factor TGFβ1 by 4 folds,
which was in correlation to the increase in TGFβ1
expression measured by fluorescent intensity
quantification. Following this, we observed
an upregulation of the downstream target
proteins: PI3 by approximately 3.5 folds, AKT
by 3 folds, mTOR by 3.5 folds, and COL1A2 by
3 folds (p<0.5**). In addition, on quantitative
estimation of soluble collagen, we observed an
upregulation of HYP expression to 40 ng/mL
compared to the control (20 ng/mL) and SFN-
treated group (22 ng/mL). AER is known to
induce reactive oxygen species production,
TGFβ1 activation, and Smad 2 phosphorylation
in buccal mucosal broblasts (BMFs) [32]. Our
results were concurrent with other studies that
have also reported a significant upregulation
of TGFβ1, COL1A2, and COL3A1 in BMFs
on treatment with 25 µg/mL of AER [8,9].
Furthermore, arecanut extract (ANE) has been
reported to exhibit a stimulatory effect on
collagen 1A1 (COL1A1) and COL3A1 by inhibiting
Matrixmetalloprotienases 2 and 9 upregulating
Tissue inhibitor of Matrixmetalloprotienases. The
study also demonstrated the inducive effect of
ANE on the PI3/AKT/mTOR pathway [33].
The interaction between TGFβ1 and the
PI3/AKT/mTOR pathway promotes fibrosis.
AKT activates downstream mTOR signaling,
maintaining low autophagy activity of broblasts,
thereby preserving the high proliferative and
antiapoptotic potential of broblasts [12]. The
PI3/AKT/mTOR pathway is a master regulator
of autophagy; increased brosis is linked with
defective autophagy, while enhanced autophagy
promotes an antifibrotic effect [34]. In the
present study, the increase in HYP and COL1A2
expression on AER induction could be attributed
to the defective autophagy of the modulated
broblasts, an outcome of the increased mTOR
expression on AER treatment.
On evaluating the other end of the spectrum,
treatment with 10µM of SFN significantly
downregulated the expression levels of TGFβ1, PI3,
AKT, mTOR, COL1A2, and HYP to approximately
1 to 1.5 folds when compared to the AER treated
group. Literature evidence states that SFN
decreases the catalytic activity of PI3 and AKT (a
positive regulator of mTOR), thereby inhibiting
mTOR and the consequential excessive deposition
of ECM proteins in Human Osteosarcoma (H2OS)
cells [20]. Furthermore, to understand the
mechanism by which SFN inhibits mTOR, we
assessed the effect of SFN on its specic binding
protein, NRF2. We observed that SFN treatment
signicantly upregulated the expression level
of the stress response transcription factor NRF2
from 0.2 fold (AER treated) to approximately 1
fold, thereby proposing that SFN inhibits mTOR
in the presence of NRF2. Our results were
consistent with a study that reported signicant
attenuation of oxidative stress in mouse models
on SFN treatment. This effect was achieved by
elevating the expression of antioxidant enzymes
such as superoxide dismutase via upregulation
of NRF2 expression [23]. On protein analysis,
we observed that SFN (10µM) treatment in
AER-induced HGFs signicantly downregulated
TGFβ1 and relative mTOR (p-mTOR/t-mTOR)
expression and upregulated NRF2 expression
when compared to the treated group. A study
reported that the antibrotic activity of SFN in
attenuating the progression of hepatic brosis is
through NRF2-mediated inhibition of the TGFβ
signaling pathway, leading to reduced expression
of type 1 collagen [19]. Another histopathological
study reported that SFN decreases dystrophic
muscle brosis in mdx mice via NRF2 mediation
of TGFβ signaling, thereby reducing collagen
deposition [35]. The above results prove that
SFN could signicantly alleviate oral brosis by
inducing autophagy through the PI3/AKT/mTOR
pathway via NRF2.
CONCLUSION
The present in vitro study elucidates the
antifibrotic potential of SFN in AER-induced
HGFs via NRF2 modulation of the PI3/AKT/
mTOR pathway. These results emphasize the
importance of exploring non-Smad pathways in
the pathogenesis of OSF for targeted intervention.
Furthermore, it also demands carrying out
in vivo studies on fibrotic models to be able
9
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
to develop mechanism based preventive and
therapeutic strategies for OSF. Overall, based
on the observed results, the authors conrm the
research hypothesis.
ABBREVIATIONS
TGFβ1 – Transforming Growth Factor Beta 1
COL1A2 – Collagen Type 1 Alpha 2
PI3K – Phosphatidylinositol 3 kinase
AKT1 – Serine/Threonine Kinase 1
mTOR – Mammalian Target of Rapamycin
NRF2 – Nuclear Factor Erythroid 2–Related
Factor 2
TBP – Tata Box Binding Protein
Author’s Contributions
PNA: Conceptualization, Investigation, Data
Curation, Writing – Original Draft Preparation,
Writing – Review & Editing. RS: Methodology,
Investigation, Data Curation, Writing – Original
Draft Preparation, Writing – Review & Editing.
RS: Formal Analysis, Writing – Review & Editing.
WE: Formal Analysis, Writing – Review & Editing.
Conict of Interest
The authors have no conicts of interest to
declare.
Funding
This research did not receive any specic
grant from funding agencies in the public,
commercial, or not-for-prot sectors.
Regulatory Statement
Not-Applicable for this study.
REFERENCES
1. Rajalalitha P, Vali S. Molecular pathogenesis of oral
submucous fibrosis: a collagen metabolic disorder. J Oral
Pathol Med. 2005;34(6):321-8. http://doi.org/10.1111/j.1600-
0714.2005.00325.x. PMid:15946178.
2. Muller S, Tilakaratne WM. Update from the 5th edition of the
World Health Organization Classification of Head and Neck
Tumors: tumours of the oral cavity and mobile tongue. Head
Neck Pathol. 2022;16(1):54-62. http://doi.org/10.1007/s12105-
021-01402-9. PMid:35312982.
3. Tilakaratne WM, Ekanayaka RP, Warnakulasuriya S. Oral
submucous fibrosis: a historical perspective and a review on
etiology and pathogenesis. Oral Surg Oral Med Oral Pathol
Oral Radiol. 2016;122(2):178-91. http://doi.org/10.1016/j.
oooo.2016.04.003. PMid:27422417.
4. Gayathri K, Malathi N, Gayathri V, Adtani PN, Ranganathan K.
Molecular pathways of oral submucous fibrosis and its progression
to malignancy. Arch Oral Biol. 2023;148:105644. http://doi.
org/10.1016/j.archoralbio.2023.105644. PMid:36804642.
5. Jian X, Jian Y, Wu X, Guo F, Hu Y, Gao X,etal. Oral submucous
fibrosis transforming into squamous cell carcinoma: a prospective
study over 31 years in mainland China. Clin Oral Investig.
2021;25(4):2249-56. http://doi.org/10.1007/s00784-020-
03541-9. PMid:32844258.
6. Shen YW, Shih YH, Fuh LJ, Shieh TM. Oral submucous fibrosis: a
review on biomarkers, pathogenic mechanisms, and treatments.
Int J Mol Sci. 2020;21(19):7231. http://doi.org/10.3390/
ijms21197231. PMid:33008091.
7. Warnakulasuriya S, Kujan O, Aguirre-Urizar JM, Bagan JV,
Gonzalez-Moles MA, Kerr AR,etal. Oral potentially malignant
disorders: a consensus report from an international seminar
on nomenclature and classification, convened by the WHO
Collaborating Centre for Oral Cancer. Oral Dis. 2021;27(8):1862-
80. http://doi.org/10.1111/odi.13704. PMid:33128420.
8. Adtani PN, Narasimhan M, Punnoose AM, Kambalachenu HR.
Antifibrotic effect of
Centella
asiatica
Linn and asiatic acid on
arecoline-induced fibrosis in human buccal fibroblasts. J Investig
Clin Dent. 2017;8(2):e12208. http://doi.org/10.1111/jicd.12208.
PMid:26840561.
9. Adtani P, Malathi N, Ranganathan K, Lokeswari S, Punnoose AM.
Antifibrotic effect of
Ocimum
basilicum
L. and linalool on arecoline-
induced fibrosis in human buccal fibroblasts. Trans Res Oral
Oncol. 2018;3:1-9. http://doi.org/10.1177/2057178X18764471.
10. Lee PH, Chu PM, Hsieh PL, Yang HW, Chueh PJ, Huang YF,etal.
Glabridin inhibits the activation of myofibroblasts in human
fibrotic buccal mucosal fibroblasts through TGF-beta/smad
signaling. Environ Toxicol. 2018;33(2):248-55. http://doi.
org/10.1002/tox.22512. PMid:29119715.
11. Xie H, Jing R, Liao X, Chen H, Xie X, Dai H, et al. Arecoline
promotes proliferation and migration of human HepG2 cells
through activation of the PI3K/AKT/mTOR pathway. Hereditas.
2022;159(1):29. http://doi.org/10.1186/s41065-022-00241-0.
PMid:35836300.
12. Wang J, Hu K, Cai X, Yang B, He Q, Wang J,etal. Targeting PI3K/
AKT signaling for treatment of idiopathic pulmonary fibrosis.
Acta Pharm Sin B. 2022;12(1):18-32. http://doi.org/10.1016/j.
apsb.2021.07.023. PMid:35127370.
13. Wang R, Song F, Li S, Wu B, Gu Y, Yuan Y. Salvianolic acid A
attenuates CCl(4)-induced liver fibrosis by regulating the
PI3K/AKT/mTOR, Bcl-2/Bax and caspase-3/cleaved caspase-3
signaling pathways. Drug Des Devel Ther. 2019;13:1889-900.
http://doi.org/10.2147/DDDT.S194787. PMid:31213776.
14. He J, Peng H, Wang M, Liu Y, Guo X, Wang B,etal. Isoliquiritigenin
inhibits TGF-beta1-induced fibrogenesis through activating
autophagy via PI3K/AKT/mTOR pathway in MRC-5 cells. Acta
Biochim Biophys Sin. 2020;52(8):810-20. http://doi.org/10.1093/
abbs/gmaa067. PMid:32638014.
15. Bendavit G, Aboulkassim T, Hilmi K, Shah S, Batist G. Nrf2
transcription factor can directly regulate mTOR: linking
cytoprotective gene expression to a major metabolic regulator
that generates redox activity. J Biol Chem. 2016;291(49):25476-
88. http://doi.org/10.1074/jbc.M116.760249. PMid:27784786.
16. Ramalingam S, Shantha S, Muralitharan S, Sudhakar U,
Thamizhchelvan H, Parvathi VD. Role of tissue markers
associated with tumor microenvironment in the progression
and immune suppression of oral squamous cell carcinoma. Med
Oncol. 2023;40(10):303. http://doi.org/10.1007/s12032-023-
02169-5. PMid:37731058.
10
Braz Dent Sci 2024 Jan/Mar;27 (1): e4172
Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al.
Therapeutic potential of Sulforaphane: modulation of NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Adtani PN et al. Therapeutic potential of Sulforaphane: modulation of
NRF2-mediated PI3/AKT/mTOR pathway in oral fibrosis
Date submitted: 2023 Dec 01
Accept submission: 2024 Mar 14
Pooja Narain Adtani
(Corresponding address)
Gulf Medical University, College of Dentistry, Department of Basic Medical and
Dental Sciences, Ajman, United Arab Emirates.
Email: dr.pooja@gmu.ac.ae
17. Arakeri G, Brennan PA. Oral submucous fibrosis: an overview
of the aetiology, pathogenesis, classification, and principles
of management. Br J Oral Maxillofac Surg. 2013;51(7):587-93.
http://doi.org/10.1016/j.bjoms.2012.08.014. PMid:23107623.
18. Chole RH, Gondivkar SM, Gadbail AR, Balsaraf S, Chaudhary S,
Dhore SV,etal. Review of drug treatment of oral submucous
fibrosis. Oral Oncol. 2012;48(5):393-8. http://doi.org/10.1016/j.
oraloncology.2011.11.021. PMid:22206808.
19. Oh CJ, Kim JY, Min AK, Park KG, Harris RA, Kim HJ, et al.
Sulforaphane attenuates hepatic fibrosis via NF-E2-related
factor 2-mediated inhibition of transforming growth factor-beta/
Smad signaling. Free Radic Biol Med. 2012;52(3):671-82. http://
doi.org/10.1016/j.freeradbiomed.2011.11.012. PMid:22155056.
20. Zhang Y, Gilmour A, Ahn YH, de la Vega L, Dinkova-Kostova AT.
The isothiocyanate sulforaphane inhibits mTOR in an NRF2-
independent manner. Phytomedicine. 2021;86:153062. http://
doi.org/10.1016/j.phymed.2019.153062. PMid:31409554.
21. Tongzhen Xu DR, Sun X, Yang G. Dual roles of sulforaphane in cancer
treatment. Anticancer Agents Med Chem. 2012;12(9):1132-42.
http://doi.org/10.2174/187152012803529691. PMid:22583415.
22. Thangapandiyan S, Ramesh M, Miltonprabu S, Hema T, Jothi GB,
Nandhini V. Sulforaphane potentially attenuates arsenic-induced
nephrotoxicity via the PI3K/Akt/Nrf2 pathway in albino Wistar
rats. Environ Sci Pollut Res Int. 2019;26(12):12247-63. http://doi.
org/10.1007/s11356-019-04502-w. PMid:30835071.
23. Yan B, Ma Z, Shi S, Hu Y, Ma T, Rong G, et al. Sulforaphane
prevents bleomycin-induced pulmonary fibrosis in mice by
inhibiting oxidative stress via nuclear factor erythroid 2-related
factor-2 activation. Mol Med Rep. 2017;15(6):4005-14. http://
doi.org/10.3892/mmr.2017.6546. PMid:28487960.
24. Rao SR, Subbarayan R, Ajitkumar S, Girija DM. 4PBA strongly
attenuates endoplasmic reticulum stress, fibrosis and
mitochondrial apoptosis markers in cyclosporine treated human
gingival fibroblasts. J Cell Physiol. 2018;233(1):60-6. http://doi.
org/10.1002/jcp.25836. PMid:28158898.
25. Mosmann T. Rapid colorimetric assay for cellular growth
and survival: application to proliferation and cytotoxicity
assays. J Immunol Methods. 1983;65(1-2):55-63. http://doi.
org/10.1016/0022-1759(83)90303-4. PMid:6606682.
26. Alley MC, Scudiero DA, Monks A, Hursey ML, Czerwinski MJ,
Fine DL,etal. Feasibility of drug screening with panels of human
tumor cell lines using a microculture tetrazolium assay. Cancer
Res. 1988;48(3):589-601. PMid:3335022.
27. Schepici G, Bramanti P, Mazzon E. Efficacy of sulforaphane in
neurodegenerative diseases. Int J Mol Sci. 2020;21(22):8637.
http://doi.org/10.3390/ijms21228637. PMid:33207780.
28. Dieffenbach C, Lowe T, Dveksler G. General concepts for PCR
primer design. PCR Methods Appl. 1993;3(3):S30-7. http://doi.
org/10.1101/gr.3.3.S30. PMid:8118394.
29. Adtani P, Narasimhan M, Ranganathan K, Punnoose A, Prasad P,
Natarajan P. Characterization of oral fibroblasts: an in vitro model
for oral fibrosis. J Oral Maxillofac Pathol. 2019;23(2):198-202.
http://doi.org/10.4103/jomfp.JOMFP_28_19. PMid:31516223.
30. Gupta SJM, Jawanda MK. Oral submucous fibrosis: an overview
of a challenging entity. Indian J Dermatol Venereol Leprol.
2021;87(6):768-77. http://doi.org/10.25259/IJDVL_371_20.
PMid:33969655.
31. Kyung SY, Kim DY, Yoon JY, Son ES, Kim YJ, Park JW, et al.
Sulforaphane attenuates pulmonary fibrosis by inhibiting the
epithelial-mesenchymal transition. BMC Pharmacol Toxicol.
2018;19(1):13. http://doi.org/10.1186/s40360-018-0204-7.
PMid:29609658.
32. Hsieh YP, Wu KJ, Chen HM, Deng YT. Arecoline activates
latent transforming growth factor beta1 via mitochondrial
reactive oxygen species in buccal fibroblasts: suppression by
epigallocatechin-3-gallate. J Formos Med Assoc. 2018;117(6):527-
34. http://doi.org/10.1016/j.jfma.2017.07.003. PMid:28720506.
33. Dai JP, Chen XX, Zhu DX, Wan QY, Chen C, Wang GF,etal. Panax
notoginseng saponins inhibit areca nut extract-induced oral
submucous fibrosis in vitro. J Oral Pathol Med. 2014;43(6):464-
70. http://doi.org/10.1111/jop.12158. PMid:24484214.
34. Peng J, Xiao X, Li S, Lyu X, Gong H, Tan S, et al. Aspirin
alleviates pulmonary fibrosis through PI3K/AKT/mTOR-mediated
autophagy pathway. Exp Gerontol. 2023;172:112085. http://doi.
org/10.1016/j.exger.2023.112085. PMid:36623738.
35. Sun C, Li S, Li D. Sulforaphane mitigates muscle fibrosis in mdx
mice via Nrf2-mediated inhibition of TGF-beta/Smad signaling.
J Appl Physiol. 2016;120(4):377-90. http://doi.org/10.1152/
japplphysiol.00721.2015. PMid:26494449.
